Basic Information

Transcription Factor Domain

TF Family: zf-GAGA
Domain: zf-GAGA domain
PFAM: PF09237
TF Group: Zinc-Coordinating Group
Description: Members of this family bind to a 5'-GAGAG-3' DNA consensus binding site, and contain a Cys2-His2 zinc finger core as well as an N-terminal extension containing two highly basic regions. The zinc finger core binds in the DNA major groove and recognises the first three GAG bases of the consensus in a manner similar to that seen in other classical zinc finger-DNA complexes. The second basic region forms a helix that interacts in the major groove recognising the last G of the consensus, while the first basic region wraps around the DNA in the minor groove and recognises the A in the fourth position of the consensus sequence [1].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 7 0.0082 30 4.6 0.1 19 49 14 44 12 47 0.85

2 7 0.00017 0.62 10.0 0.0 21 52 44 75 39 76 0.88

3 7 0.024 88 3.1 0.0 21 47 72 98 70 103 0.84

4 7 0.00056 2.1 8.3 0.1 21 46 100 125 98 133 0.90

5 7 0.0085 32 4.5 0.1 23 46 134 157 128 159 0.90

6 7 0.00058 2.1 8.2 0.0 21 51 160 190 158 191 0.88

7 7 0.00042 1.6 8.7 0.1 21 46 188 213 185 224 0.87

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	7	0.0082	30	4.6	0.1	19	49	14	44	12	47	0.85
2	7	0.00017	0.62	10.0	0.0	21	52	44	75	39	76	0.88
3	7	0.024	88	3.1	0.0	21	47	72	98	70	103	0.84
4	7	0.00056	2.1	8.3	0.1	21	46	100	125	98	133	0.90
5	7	0.0085	32	4.5	0.1	23	46	134	157	128	159	0.90
6	7	0.00058	2.1	8.2	0.0	21	51	160	190	158	191	0.88
7	7	0.00042	1.6	8.7	0.1	21	46	188	213	185	224	0.87

Coding Sequence: ATGTCACAGCAGGCGCTGGAAAGTACGGGTGTGAAAATTTCCAACTGCTCGAAACCGTTCGCCTGCACCGAATGCAACAAATTGTTTCGCCAACTGAGCACACTAACCAACCACATGAAAATACACACCGGCGAAAAACCGTACAAGTGCACGATCTGTCTGAAGGAGTTTCGCCAAACGACTACACTATCGAATCATATGAAAATTCATACAGGTGAAAAACCCTTTAGTTGTAACTTTTGTGACAAACAGTTCCGGCAGCTAAGTACACTGTCCAACCACAAGAAAATACACACCGGCGAAAAACCGTTCGAATGTTCGGTTTGCGGCAAACAGTTCCGTCAGTCCAGCACGCTCAACAGTCACATCCGGATTCATTCGGATGATAAATTTTGCATAAAACCCTTCAAATGCAGCATCTGTCCGAAGGAGTTCCGCCAGACGACGACCCTAGCGAATCATATAAAAATTCACACTGGTGAAAAACCGTACGCATGCACGTACTGCAGCAAAACGTTTCGCCAGACGGGAACGCTTTCGAACCATCTGAAGATTCATACCGGCGAAAAGCCGTTCGAGTGTTCGGTTTGCGGTAAACAGTTCCGGCAGTCCAGTACCTTGAACAGCCACATTCGCATCCATGCGGACGATAAGTATTGCAAACCTTCACAAACGGAACAGCAGCGGTCCATTGTGACGATAAACGGTGGGCTTAATTTAAAAGATGAGGACGTCAAACCGTTCTTTGCCATGATGTAA
Protein Sequence: MSQQALESTGVKISNCSKPFACTECNKLFRQLSTLTNHMKIHTGEKPYKCTICLKEFRQTTTLSNHMKIHTGEKPFSCNFCDKQFRQLSTLSNHKKIHTGEKPFECSVCGKQFRQSSTLNSHIRIHSDDKFCIKPFKCSICPKEFRQTTTLANHIKIHTGEKPYACTYCSKTFRQTGTLSNHLKIHTGEKPFECSVCGKQFRQSSTLNSHIRIHADDKYCKPSQTEQQRSIVTINGGLNLKDEDVKPFFAMM

Sequence clustering based on sequence similarity using MMseqs2

100% Identity: iTF_01462352;
90% Identity: iTF_00103141; iTF_00104070; iTF_00100455; iTF_00103825; iTF_00103355; iTF_00100671; iTF_00101824; iTF_00099809; iTF_00108548; iTF_00097925; iTF_00108808; iTF_00097911; iTF_00098170; iTF_00099998; iTF_00104545; iTF_00093861; iTF_00095788; iTF_00107372; iTF_00093616; iTF_00101360; iTF_00096053; iTF_00101110; iTF_00104824; iTF_00107133;
80% Identity: iTF_00101824;