Basic Information

Transcription Factor Domain

TF Family: zf-GAGA
Domain: zf-GAGA domain
PFAM: PF09237
TF Group: Zinc-Coordinating Group
Description: Members of this family bind to a 5'-GAGAG-3' DNA consensus binding site, and contain a Cys2-His2 zinc finger core as well as an N-terminal extension containing two highly basic regions. The zinc finger core binds in the DNA major groove and recognises the first three GAG bases of the consensus in a manner similar to that seen in other classical zinc finger-DNA complexes. The second basic region forms a helix that interacts in the major groove recognising the last G of the consensus, while the first basic region wraps around the DNA in the minor groove and recognises the A in the fourth position of the consensus sequence [1].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 5 0.0017 21 6.8 0.1 21 52 85 116 75 116 0.88

2 5 9.9e-06 0.12 13.9 0.3 21 44 113 136 110 141 0.90

3 5 0.0019 24 6.6 0.1 21 44 141 164 138 172 0.86

4 5 0.028 3.5e+02 2.9 0.0 23 43 171 191 165 195 0.85

5 5 0.03 3.8e+02 2.7 0.0 21 45 197 221 194 229 0.80

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	5	0.0017	21	6.8	0.1	21	52	85	116	75	116	0.88
2	5	9.9e-06	0.12	13.9	0.3	21	44	113	136	110	141	0.90
3	5	0.0019	24	6.6	0.1	21	44	141	164	138	172	0.86
4	5	0.028	3.5e+02	2.9	0.0	23	43	171	191	165	195	0.85
5	5	0.03	3.8e+02	2.7	0.0	21	45	197	221	194	229	0.80

Coding Sequence: ATGTTATGTTTCTGTAATGCAGACGTCCTTTTTCCCGTCGCTCTTTGTGAAATAGTCTACAAGCGTGAGCAGGCAGCCCCTCACAGTGACAGAAGTAGAGAAGATAAGGACATAAATGATAATGGGAGCAGACCCAAAACCAAACACAAGCAGCAACGCTATCACATCAGGAAGAAGAGGTACCTGTGCTCCTACTGCAACCTAACCTTCAACCGCAAAGAGACCCGCAACAGACATGTGTTTGTACACACGGGAGAGAAGCCATACAATTGCTCGGAATGTGGCGCGAAGTTTGTGCAGCGGGGACACCTGAAGAGACACGTGCTCATCCACAGGCATGAAAAACCGCACGCATGCCCAGACTGTCCGGCTCAGTTCAGAGACAAACGTAACCTTAACACGCACATGCTACAACACACAGGAGAGAAACCATTTGGTTGCTTGCTCTGTGACTCTCGGTTCAGTGACAGAAGTAACTTGAGGAGGCACGAGGCCATCCATACGGGTAAGCGTCCTTTTCCGTGTACATTGTGCAACGCTGTCTTTGCGAGGAAAGGTGACTTAAAGACGCATGCACTAGTGCATACTGGGGAAAGACCGTTTCAATGTCATATATGTGATTTCAAGTTTACTGTAAAAGGGAACTTGAACAAACACATACGTAAACACACAGAAGATAAACCTGTAAATTTGACTGTTCAAAAGAAAAGGACATCTTTGTAA
Protein Sequence: MLCFCNADVLFPVALCEIVYKREQAAPHSDRSREDKDINDNGSRPKTKHKQQRYHIRKKRYLCSYCNLTFNRKETRNRHVFVHTGEKPYNCSECGAKFVQRGHLKRHVLIHRHEKPHACPDCPAQFRDKRNLNTHMLQHTGEKPFGCLLCDSRFSDRSNLRRHEAIHTGKRPFPCTLCNAVFARKGDLKTHALVHTGERPFQCHICDFKFTVKGNLNKHIRKHTEDKPVNLTVQKKRTSL*

Sequence clustering based on sequence similarity using MMseqs2