Eedi036462.1


Basic Information
Transcription Factor Domain
Sequence Information
Similer Transcription Factors

Basic Information

Insect
Euphydryas editha
Gene Symbol
-
Assembly
GCA_036937285.1
Location
JAUPFZ010000029.1:1945041-1946033[+]

Transcription Factor Domain

TF Family
PAX
Domain
PAX domain
PFAM
PF00292
TF Group
Helix-turn-helix
Description
The paired domain, a ~126 amino acid DNA-binding domain, is found in eukaryotic transcription regulatory proteins involved in embryogenesis. Initially identified in Drosophila’s paired (prd) protein, it typically resides in the N-terminal region and may be followed by an octapeptide, a homeodomain, or a Pro-Ser-Thr-rich C terminus. Paired domain proteins act as transcription repressors or activators, with DNA-binding specificity mediated by three subdomains. Crystal structures reveal a bipartite DNA-binding paired domain: an N-terminal subdomain (PAI) and a C-terminal subdomain (RED), linked by a flexible linker. Both subdomains contain a helix-turn-helix motif that binds DNA's major groove, while the linker may bind the minor groove. Variations in domain usage across Pax proteins and isoforms determine sequence specificity.
Hmmscan Out
# of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc
1 1 3.3e-08 2.4e-05 25.6 0.4 24 72 9 57 2 116 0.88

Sequence Information

Coding Sequence
atggtagataaagtgataaaagcgagcaaaattattgcgctgcttgaagaaggttgcagtcaatgcttcgtggctcaaaggctaaatgtgagtcggtcgacagttcaaaggacctggcagcgctatcaagagaccggttccgtcaagagaaggcctggttctggcagaaagacatgtaccgaaccacgggatgatcgttttctagttagtcaagcgttgagaaatggcaaatcttcttatgtggacctcaagaacaccctcgaagaagtaggaaatgtgcaaattattctatggacggtcaggaggaggcttctcgctgctaatatacacagtcatcgcccggcacgcggccctaaattactccgtggacatcgagttgccaggcttagcttcgctcgaaattgtgtgtcatggactcatgaagactgggatagggtattgttctccgatgaagccaggatatctctgcatggtgaagaccgacgtcggcgagtgctacgtagacgaggagaacgctttgcagaggcatgttttgaagaaatcacaccttatggagggggctctgttatgttttgggcaggaataaattctatggatcgtacggagttagtcttcatcgaaaacggtacactgactggacaccaatacataacggaagttctaattccttatgcacaacccgctttaaccgctcttggcgaaaactcaatttttatggacgacaacgctcgcgcccaccggtctggcggtgtggatgcgtatatgctagaagtcggaattcgtcgtttggactggccagctagaagtccggacctcaatcccatagagcatctctgggacgttctgaagcgacgagtgagatcagtgcagccggctccgcagaccatcagagagctaaagaatgtgattaccgcggagtgggaacgtattccccaagaaaccataaaagatatactcactagcatgtccagacgaatgcaagctgtgatttaa
Protein Sequence
MVDKVIKASKIIALLEEGCSQCFVAQRLNVSRSTVQRTWQRYQETGSVKRRPGSGRKTCTEPRDDRFLVSQALRNGKSSYVDLKNTLEEVGNVQIILWTVRRRLLAANIHSHRPARGPKLLRGHRVARLSFARNCVSWTHEDWDRVLFSDEARISLHGEDRRRRVLRRRGERFAEACFEEITPYGGGSVMFWAGINSMDRTELVFIENGTLTGHQYITEVLIPYAQPALTALGENSIFMDDNARAHRSGGVDAYMLEVGIRRLDWPARSPDLNPIEHLWDVLKRRVRSVQPAPQTIRELKNVITAEWERIPQETIKDILTSMSRRMQAVI

Similar Transcription Factors

Sequence clustering based on sequence similarity using MMseqs2

100% Identity
iTF_00695553; iTF_00931362; iTF_00432129; iTF_00432161; iTF_00832929; iTF_00931297; iTF_00931329; iTF_00931361; iTF_00932513; iTF_00025218; iTF_00432130; iTF_00432162; iTF_00832930; iTF_00931330; iTF_00932514; iTF_00432131; iTF_00432163; iTF_00832931; iTF_00931299; iTF_00931331; iTF_00932515; iTF_00432132; iTF_00432164; iTF_00832900; iTF_00832932; iTF_00931300; iTF_00931332; iTF_00931364; iTF_00932516; iTF_00432133; iTF_00432165; iTF_00832933; iTF_00931301; iTF_00931333; iTF_00931365; iTF_00932517; iTF_00432134; iTF_00432166; iTF_00832934; iTF_00931302; iTF_00931334; iTF_00931366; iTF_00932518; iTF_00432135; iTF_00432167; iTF_00832935; iTF_00931303; iTF_00931335; iTF_00932519; iTF_00432136; iTF_00432168; iTF_00832936; iTF_00931304; iTF_00931336; iTF_00932520; iTF_00432137; iTF_00432169; iTF_00832937; iTF_00931305; iTF_00931337; iTF_00931369; iTF_00932521; iTF_00432138; iTF_00432170; iTF_00832938; iTF_00931306; iTF_00931338; iTF_00932522; iTF_00432139; iTF_00432171; iTF_00832939; iTF_00931307; iTF_00931339; iTF_00932523; iTF_00432140; iTF_00432172; iTF_00832940; iTF_00931308; iTF_00931340; iTF_00432141; iTF_00832941; iTF_00931309; iTF_00931341; iTF_00931373; iTF_00932525; iTF_00432142; iTF_00931310; iTF_00931342; iTF_00931374; iTF_00932526; iTF_00432143; iTF_00931311; iTF_00931343; iTF_00931375; iTF_00432144; iTF_00931312; iTF_00931344; iTF_00932496; iTF_00432145; iTF_00832913; iTF_00832945; iTF_00931313; iTF_00931345; iTF_00932497; iTF_00432146; iTF_00832914; iTF_00931314; iTF_00931346; iTF_00932498; iTF_00432147; iTF_00832915; iTF_00931315; iTF_00931347; iTF_00932499; iTF_00432148; iTF_00832916; iTF_00832980; iTF_00931316; iTF_00931348; iTF_00432149; iTF_00832917; iTF_00931317; iTF_00931349; iTF_00932501; iTF_00432150; iTF_00832918; iTF_00931318; iTF_00931350; iTF_00932502; iTF_00432151; iTF_00832919; iTF_00931287; iTF_00931319; iTF_00931351; iTF_00932503; iTF_00432152; iTF_00832920; iTF_00931288; iTF_00931320; iTF_00931352; iTF_00932504; iTF_00432153; iTF_00832921; iTF_00931321; iTF_00931353; iTF_00932505; iTF_00432154; iTF_00832922; iTF_00931322; iTF_00931354; iTF_00932506; iTF_00432155; iTF_00832923; iTF_00931323; iTF_00931355; iTF_00932507; iTF_00432156; iTF_00832924; iTF_00931292; iTF_00931324; iTF_00931356; iTF_00932508; iTF_00432125; iTF_00432157; iTF_00832925; iTF_00931325; iTF_00931357; iTF_00932509; iTF_00432126; iTF_00432158; iTF_00832926; iTF_00931294; iTF_00931326; iTF_00931358; iTF_00932510; iTF_00432127; iTF_00432159; iTF_00832927; iTF_00931327; iTF_00931359; iTF_00932511; iTF_00432128; iTF_00432160; iTF_00832928; iTF_00931328; iTF_00931360; iTF_00932512; iTF_00931298; iTF_00931363; iTF_00832942; iTF_01331474; iTF_01331507; iTF_00932500; iTF_00695529; iTF_00986031; iTF_00695530; iTF_00986061; iTF_00354049; iTF_00986049; iTF_00986051; iTF_00986052; iTF_00986053; iTF_00986054; iTF_00277319; iTF_00354055; iTF_00986055; iTF_00986056; iTF_00277321; iTF_00986057; iTF_00277322; iTF_00986058; iTF_00277323; iTF_00986059; iTF_00277324; iTF_00695564; iTF_00986028; iTF_00695533; iTF_00986029; iTF_00695566; iTF_00986030; iTF_00695535; iTF_00986063; iTF_00277328; iTF_00986032; iTF_00986033; iTF_00986034; iTF_00986035; iTF_00986036; iTF_00986037; iTF_00986039; iTF_00986040; iTF_00695545; iTF_00695546; iTF_00695547; iTF_00986043; iTF_00695548; iTF_00986044; iTF_00695549; iTF_00986045; iTF_00695550; iTF_00986046; iTF_00695551; iTF_00986047; iTF_00695552; iTF_00986048; iTF_00354050; iTF_00277320; iTF_00695569; iTF_00986062; iTF_00858515; iTF_00819138; iTF_00859430; iTF_00859431; iTF_00859432; iTF_00859433; iTF_00859434; iTF_00859435; iTF_00859436; iTF_00859437; iTF_00859438; iTF_00859439; iTF_00859440; iTF_00858517; iTF_01429910; iTF_00428093; iTF_00428094; iTF_00428095;
90% Identity
iTF_00986061;
80% Identity
-