Basic Information

Transcription Factor Domain

TF Family: HMGA
Domain: HMGA domain
PFAM: AnimalTFDB
TF Group: Unclassified Structure
Description: This entry represents the HMGA family, whose members contain DNA-binding domains, also known as AT hooks due to their ability to interact with the narrow minor groove of AT-rich DNA sequences. They play an important role in chromatin organisation [1]. The high mobility group (HMG) proteins are the most abundant and ubiquitous nonhistone chromosomal proteins. They bind to DNA and to nucleosomes and are involved in the regulation of DNA-dependent processes such as transcription, replication, recombination, and DNA repair. They can be grouped into three families: HMGB (HMG 1/2), HMGN (HMG 14/17) and HMGA (HMG I/Y). The characteristic domains are: AT-hook for the HMGA family, the HMG Box for the HMGB family, and the nucleosome-binding domain (NBD) for the members of the HMGN family [2].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 4 0.0015 22 4.6 1.1 8 15 9 16 4 17 0.89

2 4 0.43 6.4e+03 -3.3 0.4 15 19 35 39 34 39 0.60

3 4 1.1e-10 1.6e-06 27.4 9.6 4 22 57 75 55 75 0.95

4 4 1 1.5e+04 -5.1 5.9 12 18 89 95 88 100 0.60

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	4	0.0015	22	4.6	1.1	8	15	9	16	4	17	0.89
2	4	0.43	6.4e+03	-3.3	0.4	15	19	35	39	34	39	0.60
3	4	1.1e-10	1.6e-06	27.4	9.6	4	22	57	75	55	75	0.95
4	4	1	1.5e+04	-5.1	5.9	12	18	89	95	88	100	0.60

Coding Sequence: ATGTCTGATGCAGAGGTCGTTGAACCGAAGAAGGGTCGTGGACGCCCACCAAATCCGGACAAGAACAGTGTCGCACCGAAAAAGCGAGCCCGCGCACTCTCACCGAAGGAGTCAAAGGTGATGGCGGAGGAACGCGAAAAGGAGAAAACGATTGTGTCGGATGATGGTGAGGAACCGTCGCCGAAGCGTGGCCGCGGCAGACCGAAGGGCAGCACCAAGAAGTCGGCCAAATCGGCCAAGAAAGCACCAGTAGCACCGGTCGGCAGAGGTCGAGGACGTGGCCGAAAGAAACCAGTGAAGGAGGAATCCTCCGAGGAGGAAGAAGTCGAGGACGATGACGAGGATGACGAGCCGGAGGATAGCGAAGGCAATGAGGAAAATTATGAGGAATCCGATTCGTAA
Protein Sequence: MSDAEVVEPKKGRGRPPNPDKNSVAPKKRARALSPKESKVMAEEREKEKTIVSDDGEEPSPKRGRGRPKGSTKKSAKSAKKAPVAPVGRGRGRGRKKPVKEESSEEEEVEDDDEDDEPEDSEGNEENYEESDS

Sequence clustering based on sequence similarity using MMseqs2