Basic Information

Transcription Factor Domain

TF Family: BTB
Domain: zf-C2H2|ZBTB
PFAM: PF00651
TF Group: Zinc-Coordinating Group
Description: The BTB (for BR-C, ttk and bab) [6] or POZ (for Pox virus and Zinc finger) [1] domain is present near the N-terminus of a fraction of zinc finger (Pfam:PF00096) proteins and in proteins that contain the Pfam:PF01344 motif such as Kelch and a family of pox virus proteins. The BTB/POZ domain mediates homomeric dimerisation and in some instances heteromeric dimerisation [1]. The structure of the dimerised PLZF BTB/POZ domain has been solved and consists of a tightly intertwined homodimer. The central scaffolding of the protein is made up of a cluster of alpha-helices flanked by short beta-sheets at both the top and bottom of the molecule [2]. POZ domains from several zinc finger proteins have been shown to mediate transcriptional repression and to interact with components of histone deacetylase co-repressor complexes including N-CoR and SMRT [5, 3, 4]. The POZ or BTB domain is also known as BR-C/Ttk or ZiN.
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 3 0.58 2.7e+02 2.9 0.1 71 107 90 127 81 130 0.79

2 3 7.5e-22 3.5e-19 70.1 0.6 9 109 180 280 172 281 0.92

3 3 0.54 2.5e+02 3.0 0.1 75 108 278 311 272 313 0.84

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	3	0.58	2.7e+02	2.9	0.1	71	107	90	127	81	130	0.79
2	3	7.5e-22	3.5e-19	70.1	0.6	9	109	180	280	172	281	0.92
3	3	0.54	2.5e+02	3.0	0.1	75	108	278	311	272	313	0.84

Coding Sequence: ATGGTCAATAATAATCCTTTTTATGTCCAGGTCAGCCAGGATGTCATATATGGACACAAGATTTGTCAAACCAGCACAGCAAAATGGTTGTGTCTTGAAGAAATTTATCAGAAATTCTATAGGCCTAATTTCTATGACATTGGGGGCACATATATCCAAGACATAGCAGATTACTGGTTTATGTGCAAAACTGAGCAAGTCAGTACCAATTTCCTGCTGCATTTATTTGTATTCAACCGCCAAGAAGCATCCTTCAATATTACTTTAAGTTACAGCAATGAGATCACTATAGATAGGAAGTCCAAGATTGCCTACTTAGCATCCTCACCTAAGGAATATCAGTTCAAGAATATTCAAGAACTGAACCAATCATACATTACTACTTACCACTTCACGGAGCTCGATGTTGATTCATTGAAGGACAGGAAATTGTATGTTTCCATTAAATTCCCAACCACTGAATCTAAAATATTCAATCAGGAAATAGTAGAGAATATTAAGGCAGATCATGATTTTGGTGCACTGTTGTCAGATCCTATTGGTTCAGATTTCACAATAGAATCAATGGACGGAGAGAAGTTCCTGGTGCACAAGGTGTTGCTGGCTGCTCACAGTGAAGTTTTCAAGGCTATGCTTAAAGAGGAGACAGCAGAAAGCCAGAACAACTATGTAAAGCTGATAGACGTTGGCAAAGAGGATCTACAGTGCATCTTGCAGTTCATATACACAGGGACAGTGCAAGACTTACAAAACTGTAACTGCACCAATCTCCTGATTCTAGCTGACAAGTATGACCTCACTGGTCTACGGCAGTTGGTCCAGTATGCTCTCTCTCAACAACTGTCTTCTGATAATGCATTGGAAATATTAATGGTGAGTGACATGTTCAACTCGGATATGCTGAAGACTGCCGCACTAAAGTTCATAAAGAGAAACCCTACTGTGATAAAAAGTAGCGCCTTCAAAGAAATCCAGAATGCAGACCTGGTGAGAGAGCTCTGTGACTATCTGGTGCCTTGTTAG
Protein Sequence: MVNNNPFYVQVSQDVIYGHKICQTSTAKWLCLEEIYQKFYRPNFYDIGGTYIQDIADYWFMCKTEQVSTNFLLHLFVFNRQEASFNITLSYSNEITIDRKSKIAYLASSPKEYQFKNIQELNQSYITTYHFTELDVDSLKDRKLYVSIKFPTTESKIFNQEIVENIKADHDFGALLSDPIGSDFTIESMDGEKFLVHKVLLAAHSEVFKAMLKEETAESQNNYVKLIDVGKEDLQCILQFIYTGTVQDLQNCNCTNLLILADKYDLTGLRQLVQYALSQQLSSDNALEILMVSDMFNSDMLKTAALKFIKRNPTVIKSSAFKEIQNADLVRELCDYLVPC

Sequence clustering based on sequence similarity using MMseqs2