Basic Information

Transcription Factor Domain

TF Family: HMGA
Domain: HMGA domain
PFAM: AnimalTFDB
TF Group: Unclassified Structure
Description: This entry represents the HMGA family, whose members contain DNA-binding domains, also known as AT hooks due to their ability to interact with the narrow minor groove of AT-rich DNA sequences. They play an important role in chromatin organisation [1]. The high mobility group (HMG) proteins are the most abundant and ubiquitous nonhistone chromosomal proteins. They bind to DNA and to nucleosomes and are involved in the regulation of DNA-dependent processes such as transcription, replication, recombination, and DNA repair. They can be grouped into three families: HMGB (HMG 1/2), HMGN (HMG 14/17) and HMGA (HMG I/Y). The characteristic domains are: AT-hook for the HMGA family, the HMG Box for the HMGB family, and the nucleosome-binding domain (NBD) for the members of the HMGN family [2].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 3 1.3 8.4e+03 -1.9 0.7 10 15 25 30 18 31 0.59

2 3 3.9e-09 2.6e-05 25.3 5.5 8 21 58 71 54 72 0.91

3 3 8 5.3e+04 -6.1 3.2 10 12 132 134 131 134 0.81

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	3	1.3	8.4e+03	-1.9	0.7	10	15	25	30	18	31	0.59
2	3	3.9e-09	2.6e-05	25.3	5.5	8	21	58	71	54	72	0.91
3	3	8	5.3e+04	-6.1	3.2	10	12	132	134	131	134	0.81

Coding Sequence: CCGCATGCGAGAACTCAGTTGCCAGCGGGCACTGAGAAAAACCAGGACAGTGTTGGTGCTCCTACGCAAATTCGAGGGAGATGTAGGCCTAGGAAGACAGCGTTGGTGACTCGAAGAATGGCCGATCCTGCTCCGACGCCTGCCAACACGGTACCTAATGCGAGCGAGCCCCCTGCGAGACCGCGCGGCCGACCTAAGGGGTCAAAGAATCGCGTACTAAGCAGCGATAACGTTTCCCCAGCAGCAGTTGGTAGACTCAGTAGGCCAGCTGTTGGGAAGGATGAACCTGGCAACTCTTTGCCAGGTAGGTTGATGGCCGAAGAGAAAAACTCGGTGGAAATCGTGGAGCTTCCGGCAGAGGAGCCTGAAGTTACACACCAAGGATTATTGAGGAGACCCCGGAACCAGGAAGGGATTTTGCAGGAGCAAAACGTTTTGCCTGTACAGGTAGAGGAGCCTGTACAGGTAACGAAACGTCCGAGTTGGGCCAGCGAGGAAGATCTCGCCCA
Protein Sequence: PHARTQLPAGTEKNQDSVGAPTQIRGRCRPRKTALVTRRMADPAPTPANTVPNASEPPARPRGRPKGSKNRVLSSDNVSPAAVGRLSRPAVGKDEPGNSLPGRLMAEEKNSVEIVELPAEEPEVTHQGLLRRPRNQEGILQEQNVLPVQVEEPVQVTKRPSWASEEDLA

Sequence clustering based on sequence similarity using MMseqs2