Basic Information

Insect: Samia ricini
Gene Symbol: -
Assembly: None
Location: BLXV01000008:10492449-10498656[+]

Transcription Factor Domain

TF Family: zf-C2H2
Domain: zf-C2H2 domain
PFAM: PF00096
TF Group: Zinc-Coordinating Group
Description: The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [1].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 11 0.0013 0.087 13.5 3.6 1 23 283 305 283 305 0.96

2 11 6.8e-05 0.0045 17.6 1.4 1 23 380 403 380 403 0.97

3 11 0.00029 0.019 15.6 1.3 1 23 407 429 407 429 0.98

4 11 0.0012 0.075 13.7 0.5 2 23 451 473 450 473 0.93

5 11 0.092 6 7.7 1.9 1 23 477 500 477 500 0.97

6 11 0.016 1.1 10.1 0.2 2 23 523 545 522 545 0.93

7 11 6.5e-06 0.00042 20.8 1.4 2 23 556 577 555 578 0.95

8 11 0.0024 0.16 12.7 1.4 2 23 594 615 593 615 0.96

9 11 0.014 0.89 10.3 0.8 1 23 621 643 621 643 0.94

10 11 0.38 25 5.8 3.1 1 22 649 670 649 673 0.90

11 11 0.0092 0.6 10.9 0.1 3 23 730 750 729 750 0.98

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	11	0.0013	0.087	13.5	3.6	1	23	283	305	283	305	0.96
2	11	6.8e-05	0.0045	17.6	1.4	1	23	380	403	380	403	0.97
3	11	0.00029	0.019	15.6	1.3	1	23	407	429	407	429	0.98
4	11	0.0012	0.075	13.7	0.5	2	23	451	473	450	473	0.93
5	11	0.092	6	7.7	1.9	1	23	477	500	477	500	0.97
6	11	0.016	1.1	10.1	0.2	2	23	523	545	522	545	0.93
7	11	6.5e-06	0.00042	20.8	1.4	2	23	556	577	555	578	0.95
8	11	0.0024	0.16	12.7	1.4	2	23	594	615	593	615	0.96
9	11	0.014	0.89	10.3	0.8	1	23	621	643	621	643	0.94
10	11	0.38	25	5.8	3.1	1	22	649	670	649	673	0.90
11	11	0.0092	0.6	10.9	0.1	3	23	730	750	729	750	0.98

Sequence Information

Coding Sequence: atggcatccgaaaattttattaatgtgtcaactgacttgtcatgtacaaacagagatcttacagtaaaagatgaaatggatgaggaaaatttacatattaaaatggaaactgatgcacacaatgatgaaaatgatgatgtatccattgatggtgataatccatttggaaatattcagttacaagtaaaacaagaaataacattgaatatagaaaaggagagttcagattcattaagcagtgatgcttttccaataagaataaggtccttcgaaacaatgagtaaacctgatagtgttatagtagaaagaataattccagaaactcctagaattaatgtaaaagaagaaacaataactggtgaccagttcacgccatatgagtacccaaattatgaggacagcatggatagtaacgaagctgtagcactgactagagttgaagcatgtttacaagatgatggtaacattaaaatggaacatttacaggaacacacaaaggaagacttttacaaactcattaaagatgaatccgacttaacagttacggaaacccaccttatatcaaataaactcatcaacacaacatccacaatcacaaatccgcgggacggaatcatcgaatcgaagaccacaaagacattggtcatggaaataagaccaatgtcagaaggaagtttaaatctaaaaatcaccaatccagaaaagatattgccaacaaccgatgcattcatggactatgatgacaatttccaattaaattcaatcacaggcaatgttttatccttagaacaagaggcttacggtttattgaagaccaaaacgaaaaaagttctaagggacaaaattcatgcctgtccaaaatgttcaaacacatatacaaaaaaattccaattaaaaaagcacttgtcggtgcatgatgccatagagaaacgtgctttgggttttataaaaggtcagaagacacggcagcagaatcgcacgaaaaagcttatttcggaacaagacgaagaaattaaggctaaagtggaaccgttaaaaaaggaagggtatgagtgtacttgtggcaatgtttttcggcgtagaagtcgcatggaaacatgtctgaagtcgcataacatgtacgacgatacggcgtcctacccgtgcatgacgtgtcccaggcattttaaaagtaaagaagacttggcgttacatcggcgacgggttcacaggaaacggttcccgtgtaaattttgcccgacggactacaatacgcgcaaagagctcttcaaacacctgcaaatacaccagaaagttcaactaatggagtacaaagttatttcggaagttgtcaaggggaggcagaagttaaagtgttttatgtgttcaaagacttacagtgaactttctgaattgaaatcccacgtgatggacgaccacaaggagccgtatagctgtttacgttgtaaacagacattttcgaaaattattgacttcggtaatcacacgaaaacatcccaccctgaagtggaggggcagtcggtgttagatgtgctggaagccttttctaagttagtcaaagcatggaaatgtgaggaatgcggactgcagttccatgaagcagataaactcgctttacatcaaatagagaaacacagcccagaattgaaagcgaatccgcagttacaatgtcctgattgtaggcgggtattcattagtcagaaaggtttaacttctcacagaagagtccatcacagtatggagagtgtggaagaagctcagccggtcgaaactggaatcatgtgtttagaatgtaggaaaatgtgcaaagatattaacgctttgacatcgcacatgcgcttgcattccccggatagaaaatatccgtgcaaattttgtgattttcgtttcgcgacacccgagaaaaggaagactcatgcagaattgcacaccggcgatatgaaatatgtatgttttatatgtgaataccagtgtagttcagagaaccgattgaagcaacataaaatgtcattaaaacatttgaatatgaaagagttcctactgacaggcgtgccattagtcgatgaacaatcaacatcgaagcaagaagttaagaagacgttgaaaaaagaagagagagtcattaagaagagaaagagagagagggataggagagacagtgtggcttctgccgtatcagaggtggcctgtgatatatgtggtgataatttttcgagtgaaagtgaaatgttggaacataaacagacgcaccctttcatagagttccctaatgaagacaaaccgagcagaatattttttaagtaa
Protein Sequence: MASENFINVSTDLSCTNRDLTVKDEMDEENLHIKMETDAHNDENDDVSIDGDNPFGNIQLQVKQEITLNIEKESSDSLSSDAFPIRIRSFETMSKPDSVIVERIIPETPRINVKEETITGDQFTPYEYPNYEDSMDSNEAVALTRVEACLQDDGNIKMEHLQEHTKEDFYKLIKDESDLTVTETHLISNKLINTTSTITNPRDGIIESKTTKTLVMEIRPMSEGSLNLKITNPEKILPTTDAFMDYDDNFQLNSITGNVLSLEQEAYGLLKTKTKKVLRDKIHACPKCSNTYTKKFQLKKHLSVHDAIEKRALGFIKGQKTRQQNRTKKLISEQDEEIKAKVEPLKKEGYECTCGNVFRRRSRMETCLKSHNMYDDTASYPCMTCPRHFKSKEDLALHRRRVHRKRFPCKFCPTDYNTRKELFKHLQIHQKVQLMEYKVISEVVKGRQKLKCFMCSKTYSELSELKSHVMDDHKEPYSCLRCKQTFSKIIDFGNHTKTSHPEVEGQSVLDVLEAFSKLVKAWKCEECGLQFHEADKLALHQIEKHSPELKANPQLQCPDCRRVFISQKGLTSHRRVHHSMESVEEAQPVETGIMCLECRKMCKDINALTSHMRLHSPDRKYPCKFCDFRFATPEKRKTHAELHTGDMKYVCFICEYQCSSENRLKQHKMSLKHLNMKEFLLTGVPLVDEQSTSKQEVKKTLKKEERVIKKRKRERDRRDSVASAVSEVACDICGDNFSSESEMLEHKQTHPFIEFPNEDKPSRIFFK

Similar Transcription Factors

Sequence clustering based on sequence similarity using MMseqs2

100% Identity: iTF_01316692;
90% Identity: iTF_01317652;
80% Identity: -