Basic Information

Transcription Factor Domain

TF Family: zf-GAGA
Domain: zf-GAGA domain
PFAM: PF09237
TF Group: Zinc-Coordinating Group
Description: Members of this family bind to a 5'-GAGAG-3' DNA consensus binding site, and contain a Cys2-His2 zinc finger core as well as an N-terminal extension containing two highly basic regions. The zinc finger core binds in the DNA major groove and recognises the first three GAG bases of the consensus in a manner similar to that seen in other classical zinc finger-DNA complexes. The second basic region forms a helix that interacts in the major groove recognising the last G of the consensus, while the first basic region wraps around the DNA in the minor groove and recognises the A in the fourth position of the consensus sequence [1].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 7 0.11 6.3e+02 0.6 0.1 21 44 6 29 2 33 0.82

2 7 1.6e-05 0.093 12.8 0.3 20 46 33 59 26 65 0.84

3 7 0.0032 19 5.4 0.0 22 46 63 87 58 94 0.82

4 7 0.028 1.7e+02 2.4 0.1 21 44 90 113 84 117 0.75

5 7 0.0045 26 5.0 0.1 21 44 118 141 114 150 0.84

6 7 0.05 2.9e+02 1.6 0.1 21 44 146 169 144 173 0.84

7 7 0.0015 8.6 6.5 0.1 22 44 175 197 169 202 0.87

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	7	0.11	6.3e+02	0.6	0.1	21	44	6	29	2	33	0.82
2	7	1.6e-05	0.093	12.8	0.3	20	46	33	59	26	65	0.84
3	7	0.0032	19	5.4	0.0	22	46	63	87	58	94	0.82
4	7	0.028	1.7e+02	2.4	0.1	21	44	90	113	84	117	0.75
5	7	0.0045	26	5.0	0.1	21	44	118	141	114	150	0.84
6	7	0.05	2.9e+02	1.6	0.1	21	44	146	169	144	173	0.84
7	7	0.0015	8.6	6.5	0.1	22	44	175	197	169	202	0.87

Coding Sequence: ATGCGAAATCACACTGAGGAGTCGCCCTACGAGTGCAAAGTGTGTGGCAAGCGCTTCAAACAATGCGGCTCTTTGGTGTACCACATGAGAAGTCACACTGGAGAGCAGCCTTACTCGTGCGAGATATGCGGCAAACGATATCGCCAATCTGGAACATTGACGGCCCACATGAGAGTGCACACGGGACAGAGGCCTTTCCTGTGTTCGATTTGCGGCACAGGATTCCGACAAGCTCCCGACCTCGGCTATCACATGAGGACCCACACCAAAGAGAAACCGTACATGTGTAACATATGCGGGAAAACCATGTCGATGCAGTCGCACTTGGTGCAGCATATGCGCATTCATACGGGAGAGCGACCCTTCAAATGCGGCGTATGTGACAAGGCCTTTCCGTCCTCGACTCGCTTGAAGAGACACGAAATAATCCACACCAGTCTCAAACCGTACTCATGTGAGGTCTGTTTGAAATCTTTTAATAGAACGAGCAGTTTGAGGGTTCATTCGAAAATCCACACAGATGAGAGATCGCACTTGTGTCCGATTTGCGGGAAAGGTTTTATACAGCCGAACGCTTTAAGATCGCATCTACTTTCGCATTCCTCAGAGTTAACACGTTAG
Protein Sequence: MRNHTEESPYECKVCGKRFKQCGSLVYHMRSHTGEQPYSCEICGKRYRQSGTLTAHMRVHTGQRPFLCSICGTGFRQAPDLGYHMRTHTKEKPYMCNICGKTMSMQSHLVQHMRIHTGERPFKCGVCDKAFPSSTRLKRHEIIHTSLKPYSCEVCLKSFNRTSSLRVHSKIHTDERSHLCPICGKGFIQPNALRSHLLSHSSELTR

Sequence clustering based on sequence similarity using MMseqs2