Basic Information

Transcription Factor Domain

TF Family: BTB
Domain: zf-C2H2|ZBTB
PFAM: PF00651
TF Group: Zinc-Coordinating Group
Description: The BTB (for BR-C, ttk and bab) [6] or POZ (for Pox virus and Zinc finger) [1] domain is present near the N-terminus of a fraction of zinc finger (Pfam:PF00096) proteins and in proteins that contain the Pfam:PF01344 motif such as Kelch and a family of pox virus proteins. The BTB/POZ domain mediates homomeric dimerisation and in some instances heteromeric dimerisation [1]. The structure of the dimerised PLZF BTB/POZ domain has been solved and consists of a tightly intertwined homodimer. The central scaffolding of the protein is made up of a cluster of alpha-helices flanked by short beta-sheets at both the top and bottom of the molecule [2]. POZ domains from several zinc finger proteins have been shown to mediate transcriptional repression and to interact with components of histone deacetylase co-repressor complexes including N-CoR and SMRT [5, 3, 4]. The POZ or BTB domain is also known as BR-C/Ttk or ZiN.
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 4 0.4 2.6e+02 3.6 0.0 83 108 19 44 14 46 0.91

2 4 0.23 1.5e+02 4.3 0.1 76 108 44 76 41 78 0.90

3 4 2.1e-17 1.4e-14 56.0 0.0 5 96 134 220 130 235 0.82

4 4 1.6 1e+03 1.6 0.1 77 101 235 259 224 267 0.77

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	4	0.4	2.6e+02	3.6	0.0	83	108	19	44	14	46	0.91
2	4	0.23	1.5e+02	4.3	0.1	76	108	44	76	41	78	0.90
3	4	2.1e-17	1.4e-14	56.0	0.0	5	96	134	220	130	235	0.82
4	4	1.6	1e+03	1.6	0.1	77	101	235	259	224	267	0.77

Coding Sequence: ATGGTCTTTATCTTATTGCACGAGAACCCAGCATCCCCGGCCACCGTGCTGCTGGTGATGGAAGTGCTAGGGTTGGCGCTCCGGCTGAACATCCCGCGGCTGCGCGGGCTGTGCGCGCGGTACTTGCGCGCCAACATGTGCGCCAGCAACGTGCTGCCCGCGCTGCACGCCGCACACCACATGCGTCTCTACTGCATCAAGGAGTATTGCCTCAGGTTTGTAATAAAAGACTACAATTTCACCTCGATTGTGATGTCGAAGGACTTCGAGGAGATGGAACAGAGTCTAATGGTGGAAGTTATCAGGAGAAGACAACAACCGCCCGTGAAACAACCGGTCGCCCAGGAAAACGATGAAGAAATCGTTGGCACTACTTTGGAGCAAGACATGTCAGCTCTGCTCCAAAGCGGGTCGGAGCTAAGCGACGTAACGCTGCGGGTGGGAGCACAGTCGAGGCCGGCGCATCGGTCAGTTCTAGCGTCACGGGCGGCTTACTTCGAAGCACTGTTCCGGTCCTTCGCCCCCAAGGACAACGTCGTTAATATAACGTCTGAAGAAGCATTCGATTCGTTACTGCGATATATCTACTATGGAGACACAAGCATGCGCACAGAAGATTCACTCTATCTCTTTCAAGCGCCAATTTACTATGGTTTCACAAACAACCGGCTGCAAGTGTTCTGCAAGCACAATTTGCAAAGCAACGTGACTCCAGAAAACGTGCTCGCTATCCTGCAAGCAGCGGACAGGATGCTAGCTACTGACATTAAAGAGTACGCGCTCAAGATGATCGTTTATAACTTCAATGTGGTTGCCAATCAGAAGGCGATGCGCACATTGTCTCAGCCGCTCCTAGTGGACATATGCCAAGTAGTATCAAAAGAACTTGTTTTCTGCAGCCACTGCCCCAAGCCCATGGTCCTACTCGCATCATCGTCATCAGATACTATCAGTGAGGAAAGTAATAAACCTGACAAGGACAAGCACAAGTGTGGGAAAACATAG
Protein Sequence: MVFILLHENPASPATVLLVMEVLGLALRLNIPRLRGLCARYLRANMCASNVLPALHAAHHMRLYCIKEYCLRFVIKDYNFTSIVMSKDFEEMEQSLMVEVIRRRQQPPVKQPVAQENDEEIVGTTLEQDMSALLQSGSELSDVTLRVGAQSRPAHRSVLASRAAYFEALFRSFAPKDNVVNITSEEAFDSLLRYIYYGDTSMRTEDSLYLFQAPIYYGFTNNRLQVFCKHNLQSNVTPENVLAILQAADRMLATDIKEYALKMIVYNFNVVANQKAMRTLSQPLLVDICQVVSKELVFCSHCPKPMVLLASSSSDTISEESNKPDKDKHKCGKT

Sequence clustering based on sequence similarity using MMseqs2