Basic Information

Transcription Factor Domain

TF Family: zf-GAGA
Domain: zf-GAGA domain
PFAM: PF09237
TF Group: Zinc-Coordinating Group
Description: Members of this family bind to a 5'-GAGAG-3' DNA consensus binding site, and contain a Cys2-His2 zinc finger core as well as an N-terminal extension containing two highly basic regions. The zinc finger core binds in the DNA major groove and recognises the first three GAG bases of the consensus in a manner similar to that seen in other classical zinc finger-DNA complexes. The second basic region forms a helix that interacts in the major groove recognising the last G of the consensus, while the first basic region wraps around the DNA in the minor groove and recognises the A in the fourth position of the consensus sequence [1].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 5 0.014 1.6e+02 1.9 1.0 21 49 48 76 36 80 0.83

2 5 0.00027 3.2 7.4 0.1 21 44 105 128 93 133 0.88

3 5 0.0007 8.1 6.1 0.1 26 45 199 218 195 222 0.90

4 5 0.00021 2.5 7.7 0.5 21 45 222 246 218 251 0.89

5 5 3.1e-06 0.036 13.6 0.1 20 45 250 275 246 280 0.89

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	5	0.014	1.6e+02	1.9	1.0	21	49	48	76	36	80	0.83
2	5	0.00027	3.2	7.4	0.1	21	44	105	128	93	133	0.88
3	5	0.0007	8.1	6.1	0.1	26	45	199	218	195	222	0.90
4	5	0.00021	2.5	7.7	0.5	21	45	222	246	218	251	0.89
5	5	3.1e-06	0.036	13.6	0.1	20	45	250	275	246	280	0.89

Coding Sequence: ATGCTGAATAAATTGCCTATGTTAGATCTGCATTTGATTTCTTGCCACGACTACCCAGCGGATAAATATCAATGCGAACAGTGTCCGAAAACCTACAGCTGGCTTCCCTGTTTAACGAGGCATCAATCTCTGTTTCACAGAAGTTACCAAACTTTCCCTTGCGAAAGCTGCACTAAAACGTTTATAAATCCTAGCAATTTACAACGTCATATACGAACCCACCACATTGGAGCTCGTTCGCACGTGTGCCAACAGTGTGGTAAAGCTTTCGCGACTTCATCAGGTCTCAAACAACACACGCACATACATTCCAGCGTTAAGCCTTTCAGATGTGAAGTTTGTTTCAAGGCGTATACCCAATTCTCGAACTTATGCAGACACAAAAGAATGCATATTGGTTGCAGAATGCAAATAAAATGCGACAAATGTAACCAATCGTTCAGCACTGGTACCTCGTTAACCAAACACAAGAGGTTTTGCGACTCATCCGCTACCACAGCTATTACAAATCCTCCGTTACCACTACCAAATATACCATATATGCATCACCAGCTCTCCGCTGGTATTGGTATGACCAAAATCAAAGACCGATACGCTTGTAAATTCTGCGGCAAGGTATTCCCAAGATCCGCCAATTTAACCAGACACCTGAGAACTCATACAGGTGAACAACCCTACAAGTGCAAGTACTGCGAACGCTCGTTCAGCATATCATCTAATCTGCAAAGGCACGTTCGCAACATCCACAACAAAGAAAAGCCCTTCAAATGCCCTCTTTGCGATCGCTGCTTCGGTCAACAAACGAATCTAGATCGCCATCTCAAGAAACACGAAGCCGGTGAAAGCAACGGTCTCACATCAGCTGCTGAGAGCCCGGAAAGCGTCAACGAAAACCCTAGGGAGGACGCGTATTTCGACGAAATACGCAACTTCATGGCCTGGTTCAAGCCTTAA
Protein Sequence: MLNKLPMLDLHLISCHDYPADKYQCEQCPKTYSWLPCLTRHQSLFHRSYQTFPCESCTKTFINPSNLQRHIRTHHIGARSHVCQQCGKAFATSSGLKQHTHIHSSVKPFRCEVCFKAYTQFSNLCRHKRMHIGCRMQIKCDKCNQSFSTGTSLTKHKRFCDSSATTAITNPPLPLPNIPYMHHQLSAGIGMTKIKDRYACKFCGKVFPRSANLTRHLRTHTGEQPYKCKYCERSFSISSNLQRHVRNIHNKEKPFKCPLCDRCFGQQTNLDRHLKKHEAGESNGLTSAAESPESVNENPREDAYFDEIRNFMAWFKP

Sequence clustering based on sequence similarity using MMseqs2