Basic Information

Insect: Myzus cerasi
Gene Symbol: -
Assembly: None
Location: Mc1365:636-7143[-]

Transcription Factor Domain

TF Family: HMG
Domain: HMG_box domain
PFAM: PF00505
TF Group: Other Alpha-Helix Group
Description: High mobility group (HMG) box domains are involved in binding DNA, and may be involved in protein-protein interactions as well. The structure of the HMG-box domain consists of three helices in an irregular array. HMG-box domains are found in one or more copies in HMG-box proteins, which form a large, diverse family involved in the regulation of DNA-dependent processes such as transcription, replication, and strand repair, all of which require the bending and unwinding of chromatin. Many of these proteins are regulators of gene expression. HMG-box proteins are found in a variety of eukaryotic organisms, and can be broadly divided into two groups, based on sequence-dependent and sequence-independent DNA recognition; the former usually contain one HMG-box motif, while the latter can contain multiple HMG-box motifs. HMG-box domains can be found in single or multiple copies in the following protein classes: HMG1 and HMG2 non-histone components of chromatin; SRY (sex determining region Y protein) involved in differential gonadogenesis; the SOX family of transcription factors [1]; sequence-specific LEF1 (lymphoid enhancer binding factor 1) and TCF-1 (T-cell factor 1) involved in regulation of organogenesis and thymocyte differentiation [2]; structure-specific recognition protein SSRP involved in transcription and replication; MTF1 mitochondrial transcription factor; nucleolar transcription factors UBF 1/2 (upstream binding factor) involved in transcription by RNA polymerase I; Abf2 yeast ARS-binding factor [3]; yeast transcription factors lxr1, Rox1, Nhp6b and Spp41; mating type proteins (MAT) involved in the sexual reproduction of fungi [4]; and the YABBY plant-specific transcription factors.
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 5 0.32 3.7e+02 2.3 0.1 18 56 52 93 48 101 0.85

2 5 2.4e-18 2.9e-15 57.1 1.3 3 66 154 217 152 220 0.96

3 5 2.8e-07 0.00033 21.6 2.8 3 65 230 290 228 292 0.82

4 5 6.8e-08 8e-05 23.6 1.8 2 68 325 389 323 390 0.92

5 5 0.0081 9.4 7.4 1.2 37 66 484 513 481 515 0.92

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	5	0.32	3.7e+02	2.3	0.1	18	56	52	93	48	101	0.85
2	5	2.4e-18	2.9e-15	57.1	1.3	3	66	154	217	152	220	0.96
3	5	2.8e-07	0.00033	21.6	2.8	3	65	230	290	228	292	0.82
4	5	6.8e-08	8e-05	23.6	1.8	2	68	325	389	323	390	0.92
5	5	0.0081	9.4	7.4	1.2	37	66	484	513	481	515	0.92

Sequence Information

Coding Sequence: ATGGGTTTGGACCGTAAAAGAAAGTCAATTAATGCTGTTCAAGGCACTGATAAAAAACGGAAAAGCATTATAGAAAAAAAGTCTTCATCATCTTCTTCTTCTTCTTCTGAAGATTCTGATGAGCACTCTGATCATGATAATGGATTAACTAATGAAGTAAAAAATGAAAATCCTGTTATCAGTCGTTGGCCTCAAGATGACATTCAAAAGCTACTATCTAAAATGGAGTCAGCACTTCCTAAAACTGACAATCAAACATTTCGAAGTCGATTCACCAAATTAGACTGGGAAAAAATTCAATTTGATAATTATAGTAAAGAAGAATGTCAATCTACTTGGTTAGCTATACAAGATCAGCTCAGGACATATAAAACTATAGGTGATCTTATTCATGATGCTAGAAATTTATTGGAAACTAAAGGCATTGATACATATCGTTCAAAAACAAATCGGTTACAAAAACCTAGAACAGCATACATGTTATATTACACAGAACTTCTACAAAAATACAGGAAAAAACATCCAGATTTAAAATTGCCACAGTTGACACAAATCATTGCTGAAAAATATAATAAATTATCACCTGACAAGAAACAAATATTTCTTGATAGAGCCCAAAAATTAAAGACTGAATATACTGAAATGGTTGATAAAACAAATGTAGGTTTCAAATTTAAGGAATCAAATAAACCAAAAACTCCGTTTCAAGTTTTTATGGAATCAAAATCATCAGATTTAGATTTAGGTAATGTTGATAAAGCTGATGTTCAAAACAAATTAAAAGAAAAATGGGAAGCTATGTCAGAAAAGAAAAAATCAAAATGGATTAAATTGGCAAACGAACGAGAACAGACATATTTAAACAATCTAAAAGAAGACCACAAAAATGATCCTGCTTTCACTATGCCAACAAAAAGTGCATTGACCAAAGGTGATAGAAATATTTTGGATTCTCAATCAGGGAAACCAAAAAAACCTCCAGTCAATAATTATAGTCTTTTCTCTAAAGAAATGTTACAAAGTGATGCATTAAATGGTATTCCTCCTAAAGAGAGAATGTCAGCATTAGCAAAGAAATGGAAAGCTTTTTCTAATGAAGAGCGGCAAATTTATTCTGATAAGTTGAAAGTTATAACTGAGCGATATAAAACTGAATTTGATGCATATTTAAAAACACTACCAGAAGATGAAAAACAATTAGAAATGGCTAAAAATAAAATAAAACCAAAAAAATCTGAGAAACCTGAACCAAAAGTTGTACCTAGAATTAATGCTAGAGAAGTTATCTCTGAAAAACCCACAGAAAAGTCTAAGAAAAAAGATACTTCAAAATATAACTCAAAAACTAAAACATTCAAAAATGAACCAAAGCCAGTACCTTATGAAAATGCATTTGAATTATACAGAAGTAAATTAGAACCGAACGATAAACACCCTATTACAAGCTTAGAAGAGTGGAACAAAAAAAATGGACGAAAACAAATAACATATGAAAATGAACTTAAGACCCTTAAAAAAGAATATATGAAAAATTTGAAAGTATTTTTAAGATCCCTTTCTGCGGATGATTTGCAATTGTATCTAAAACTGAGAAAACCAGAATTTTTAACTGAAAAAAATGATTCTAGTGCATCAGAGAAGGAAGGCGATTCTTCATCTGAAGAGGAAGATGATAATGAGGAGGAGGAGGATGACGACGATGATGATTCAGAGTAA
Protein Sequence: MGLDRKRKSINAVQGTDKKRKSIIEKKSSSSSSSSSEDSDEHSDHDNGLTNEVKNENPVISRWPQDDIQKLLSKMESALPKTDNQTFRSRFTKLDWEKIQFDNYSKEECQSTWLAIQDQLRTYKTIGDLIHDARNLLETKGIDTYRSKTNRLQKPRTAYMLYYTELLQKYRKKHPDLKLPQLTQIIAEKYNKLSPDKKQIFLDRAQKLKTEYTEMVDKTNVGFKFKESNKPKTPFQVFMESKSSDLDLGNVDKADVQNKLKEKWEAMSEKKKSKWIKLANEREQTYLNNLKEDHKNDPAFTMPTKSALTKGDRNILDSQSGKPKKPPVNNYSLFSKEMLQSDALNGIPPKERMSALAKKWKAFSNEERQIYSDKLKVITERYKTEFDAYLKTLPEDEKQLEMAKNKIKPKKSEKPEPKVVPRINAREVISEKPTEKSKKKDTSKYNSKTKTFKNEPKPVPYENAFELYRSKLEPNDKHPITSLEEWNKKNGRKQITYENELKTLKKEYMKNLKVFLRSLSADDLQLYLKLRKPEFLTEKNDSSASEKEGDSSSEEEDDNEEEEDDDDDDSE

Similar Transcription Factors

Sequence clustering based on sequence similarity using MMseqs2

100% Identity: iTF_01167574;
90% Identity: iTF_00184550;
80% Identity: -