Basic Information

Transcription Factor Domain

TF Family: BTB
Domain: zf-C2H2|ZBTB
PFAM: PF00651
TF Group: Zinc-Coordinating Group
Description: The BTB (for BR-C, ttk and bab) [6] or POZ (for Pox virus and Zinc finger) [1] domain is present near the N-terminus of a fraction of zinc finger (Pfam:PF00096) proteins and in proteins that contain the Pfam:PF01344 motif such as Kelch and a family of pox virus proteins. The BTB/POZ domain mediates homomeric dimerisation and in some instances heteromeric dimerisation [1]. The structure of the dimerised PLZF BTB/POZ domain has been solved and consists of a tightly intertwined homodimer. The central scaffolding of the protein is made up of a cluster of alpha-helices flanked by short beta-sheets at both the top and bottom of the molecule [2]. POZ domains from several zinc finger proteins have been shown to mediate transcriptional repression and to interact with components of histone deacetylase co-repressor complexes including N-CoR and SMRT [5, 3, 4]. The POZ or BTB domain is also known as BR-C/Ttk or ZiN.
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 3 4.3 2e+04 -0.7 0.0 5 35 126 159 124 180 0.79

2 3 3.3e-08 0.00015 25.4 0.1 47 109 212 273 201 274 0.89

3 3 0.12 5.6e+02 4.2 0.0 78 109 274 305 272 306 0.88

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	3	4.3	2e+04	-0.7	0.0	5	35	126	159	124	180	0.79
2	3	3.3e-08	0.00015	25.4	0.1	47	109	212	273	201	274	0.89
3	3	0.12	5.6e+02	4.2	0.0	78	109	274	305	272	306	0.88

Coding Sequence: ATGATAGCTATACCTTTAAGCCTACCATTACATGTGTGTTTACTTACAGGCCCCAATGGCAAAAAGATAACTAACCCAGTCGTATTGTGTCTAAACTTAGTAGGCTGTGAAACAGAAGAAACTGGTCAAGCGCGAGTTAGATTCCAATTCGGAACATGGGACGCTAAGACAAAGTCTTGGGAACGCTTTTCAATATCTACAGTAATTATCAATTTAGTAAATATGGACGAGATACATTCGATTGGTTATGAAACGTTAAAAATATCTGAGCGCCATTTAAAAAATAAAGATATTAGTTTCATGGTAAAGATTCAAGTAATTCATACTGAAGAGGAAAGGCATAGTTTATCACAGGATTTAACAAGAATTTTAAGTTTGGAGAGTGAAAGTCTTACTGATACCATTGTCGAGTGCTGTGACGGTGATAATGTTAAAACATTAAAAGTTCACAGTTTTCCAATTAAAGTACGAAGTCCCTTACTGGGTCTAAATTTAAAGAAATACGCAGTGGCAGGAAAGAACTCAGTCATTAGTTCCGAGAAAAACTTGGTTAAACAACTCGATAATGTATATTACAAAGCGTATCACGAAGAAGATATGAATTTACTAAAATCAATATGTTTCTTATCTTTTCAGAACATCAACTACAAGTTAGATTTACGAGAACTAAATTACGGCACGGCTCAGGAACTTTTCCGTTACATTTATTCAGATAAAGTTGACAATACTGAATTGTACGCTAATAAACTTCTGCCATTCTCTATAAAATTTAATTTATCAGGATTGACTACTTTATGTGAAAGAGCTTTATTAGAAAGTATTACACCAAACAACGTAGCCAACATATTAATTCTTGCTGATCAATATGGTTGTGAAAATTTGCGGAAAACAGCTTTACAGTATTGTGAACAATCAGAAGAAATTAGAAACAGTGTAAATATTGGTAAGTAA
Protein Sequence: MIAIPLSLPLHVCLLTGPNGKKITNPVVLCLNLVGCETEETGQARVRFQFGTWDAKTKSWERFSISTVIINLVNMDEIHSIGYETLKISERHLKNKDISFMVKIQVIHTEEERHSLSQDLTRILSLESESLTDTIVECCDGDNVKTLKVHSFPIKVRSPLLGLNLKKYAVAGKNSVISSEKNLVKQLDNVYYKAYHEEDMNLLKSICFLSFQNINYKLDLRELNYGTAQELFRYIYSDKVDNTELYANKLLPFSIKFNLSGLTTLCERALLESITPNNVANILILADQYGCENLRKTALQYCEQSEEIRNSVNIGK

Sequence clustering based on sequence similarity using MMseqs2