Basic Information

Transcription Factor Domain

TF Family: PAX
Domain: PAX domain
PFAM: PF00292
TF Group: Helix-turn-helix
Description: The paired domain, a ~126 amino acid DNA-binding domain, is found in eukaryotic transcription regulatory proteins involved in embryogenesis. Initially identified in Drosophila’s paired (prd) protein, it typically resides in the N-terminal region and may be followed by an octapeptide, a homeodomain, or a Pro-Ser-Thr-rich C terminus. Paired domain proteins act as transcription repressors or activators, with DNA-binding specificity mediated by three subdomains. Crystal structures reveal a bipartite DNA-binding paired domain: an N-terminal subdomain (PAI) and a C-terminal subdomain (RED), linked by a flexible linker. Both subdomains contain a helix-turn-helix motif that binds DNA's major groove, while the linker may bind the minor groove. Variations in domain usage across Pax proteins and isoforms determine sequence specificity.
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 1 8.2e-09 1.4e-06 28.8 3.2 21 125 10 109 5 109 0.89

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	1	8.2e-09	1.4e-06	28.8	3.2	21	125	10	109	5	109	0.89

Coding Sequence: ATGGGAAAAGTTTGCGAAATTAGTATCGAAACGCGATCTGCCATCGTTGTTCTCCATAATGAAGGCAAATCTGAACGTGAGATTGCATCTCAACTCAAGTTATCAAAGACTTGTGTTCATCGCACTATTGTGCGGTACAAACAAACTGGCAGTAATCAAGATCGTCCGCGCTCCGGGAGACCAAGAGCTACGACTTCTAGTGAAGACAAATTTATTGTGGTAACCAGCAAGCGAAACAGACGCCTAACAGCCCCAGAAATCCGCGTTGAAGTCAACAAATCTCGGGAAAAACCTGTGTCAGTGTCTACAGTGAAAAGACGATTGCGAGACGCCAAGTTGTATGGTCGCGTTGCTGTTCGAAAACCTCTTCTAAAACCGCAGAATAAGAAAAAACGGTTGCAGCGGAGCTGTGAACTAGATTCTACGCTAAGAAGTTTAGAGCTCATTGCCTGGGGACTTCCACACAGACAACACAGGTTAGAATAA
Protein Sequence: MGKVCEISIETRSAIVVLHNEGKSEREIASQLKLSKTCVHRTIVRYKQTGSNQDRPRSGRPRATTSSEDKFIVVTSKRNRRLTAPEIRVEVNKSREKPVSVSTVKRRLRDAKLYGRVAVRKPLLKPQNKKKRLQRSCELDSTLRSLELIAWGLPHRQHRLE

Sequence clustering based on sequence similarity using MMseqs2

100% Identity: iTF_00971321;
90% Identity: iTF_00971265; iTF_00971297; iTF_00971302; iTF_00971208; iTF_00971274; iTF_00971211; iTF_00971244; iTF_00971284; iTF_00971221; iTF_00971253; iTF_00971321; iTF_00971228; iTF_00971229;
80% Identity: iTF_00971229;