Mgen000678.1
Basic Information
- Insect
- Megalopta genalis
- Gene Symbol
- -
- Assembly
- GCA_011865705.1
- Location
- NW:122112-125256[+]
Transcription Factor Domain
- TF Family
- zf-GAGA
- Domain
- zf-GAGA domain
- PFAM
- PF09237
- TF Group
- Zinc-Coordinating Group
- Description
- Members of this family bind to a 5'-GAGAG-3' DNA consensus binding site, and contain a Cys2-His2 zinc finger core as well as an N-terminal extension containing two highly basic regions. The zinc finger core binds in the DNA major groove and recognises the first three GAG bases of the consensus in a manner similar to that seen in other classical zinc finger-DNA complexes. The second basic region forms a helix that interacts in the major groove recognising the last G of the consensus, while the first basic region wraps around the DNA in the minor groove and recognises the A in the fourth position of the consensus sequence [1].
- Hmmscan Out
-
# of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc 1 5 0.00025 0.8 9.0 0.2 16 45 22 51 12 57 0.86 2 5 9.7e-05 0.3 10.3 1.5 25 48 60 83 51 86 0.89 3 5 0.064 2e+02 1.3 0.5 1 12 134 145 119 158 0.65 4 5 0.00024 0.74 9.1 0.2 16 45 188 217 175 226 0.86 5 5 9.6e-05 0.3 10.3 1.5 25 48 226 249 217 252 0.89
Sequence Information
- Coding Sequence
- ATGAAACACAAGGTATATGGGTTCAGGAAGAGCCACGTGTACAGGAGCCAGGTGTCGCGGGGCCGTCACACAGCGCCGGAGGAGTCGCCGTTGGAGTGCCCGCAGTGCGGCCGGACGTACAAGATGAAGCGGAACCTGAAGACCCACATGAGATTCGAGTGCGGCGGCCAACGGAACTTCACGTGCCACATTTGCCCGGCCAGATACACTCAGAATATCGGACTGCGACGGCATCTGCTGCAAAAGCACAACACCTATCTGCCNGAGCGACTAGCCGGAAGCGTTTATGGTTGCTCGAGCGAACGATCCGTCGGCGAATCCGTCGTCCCCGGAAGCTTCCGGCTCGAGAAAAAAAAGGTTTCTCGATCGACGTTACCCGCGCTGGTCGGCTCGCCGAAGCCGCGCTCCAGGAGAGCGTTTCGTCCGGACGGCGTTTCGCCCGTTCGTCGTCCACGGAGTCGCGATCTCGCCGCTTTCTCTGATCTCTCTAACGCATTATCCCGTTTGTATTTTTCAGGGTTCAGGAAGAGCCACGTGTACAGGAGCCAGGTGTCGCGGGGCCGTCACACAGCGCCGGAGGAGTCGCCGTTGGAGTGCCCGCAGTGCGGCCGGACGTACAAGATGAAGCGGAACCTGAAGACCCACATGAGATTCGAGTGCGGCGGCCAACGGAACTTCACGTGCCACATTTGCCCGGCCAGATACACTCAGAATATCGGACTGCGACGGCATCTGCTGCAAAAGCACAACACCTATCTGCCGCCGAAATTCTCCATTCCGAAGCGCATCTTCGCCGGCGCCCACGAACAGAAGCCGTTCACTTGA
- Protein Sequence
- MKHKVYGFRKSHVYRSQVSRGRHTAPEESPLECPQCGRTYKMKRNLKTHMRFECGGQRNFTCHICPARYTQNIGLRRHLLQKHNTYLPERLAGSVYGCSSERSVGESVVPGSFRLEKKKVSRSTLPALVGSPKPRSRRAFRPDGVSPVRRPRSRDLAAFSDLSNALSRLYFSGFRKSHVYRSQVSRGRHTAPEESPLECPQCGRTYKMKRNLKTHMRFECGGQRNFTCHICPARYTQNIGLRRHLLQKHNTYLPPKFSIPKRIFAGAHEQKPFT
Similar Transcription Factors
Sequence clustering based on sequence similarity using MMseqs2
- 100% Identity
- iTF_00966235;
- 90% Identity
- iTF_00966235;
- 80% Identity
- iTF_00966235;