Basic Information

Transcription Factor Domain

TF Family: HMGA
Domain: HMGA domain
PFAM: AnimalTFDB
TF Group: Unclassified Structure
Description: This entry represents the HMGA family, whose members contain DNA-binding domains, also known as AT hooks due to their ability to interact with the narrow minor groove of AT-rich DNA sequences. They play an important role in chromatin organisation [1]. The high mobility group (HMG) proteins are the most abundant and ubiquitous nonhistone chromosomal proteins. They bind to DNA and to nucleosomes and are involved in the regulation of DNA-dependent processes such as transcription, replication, recombination, and DNA repair. They can be grouped into three families: HMGB (HMG 1/2), HMGN (HMG 14/17) and HMGA (HMG I/Y). The characteristic domains are: AT-hook for the HMGA family, the HMG Box for the HMGB family, and the nucleosome-binding domain (NBD) for the members of the HMGN family [2].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 3 0.00036 15 6.5 0.3 4 15 5 16 3 17 0.83

2 3 1.4e-09 6.1e-05 23.8 1.2 3 21 49 67 47 68 0.87

3 3 0.54 2.3e+04 -3.6 3.7 9 16 77 84 72 86 0.71

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	3	0.00036	15	6.5	0.3	4	15	5	16	3	17	0.83
2	3	1.4e-09	6.1e-05	23.8	1.2	3	21	49	67	47	68	0.87
3	3	0.54	2.3e+04	-3.6	3.7	9	16	77	84	72	86	0.71

Coding Sequence: ATGTCGGACACAGAGGTCGTTGAACCGAAAAAAGGTCGAGGCCGCCCAAGCAATCCCGAGAAGAACAGCGTCGCTCCCAAAAAGCGAGCACGCGCTGCTTCACCAAAGGATAAAGCAGAGGAAAAGGACAAGGCACTTGCCTCGGACGAGGAGCCATCGGCAAAGCGTGGTCGGGGTAGACCGAAGGGCACCGCGAAAAAAGCGCCAAAGGCTAAAAAACCAGATACCAAAAAAGGCCGCGGAAGAGGTAAAAAGAAGCCGGCCAAGGACGAGTCCAGCGAAGAGGAGGAGGATGACGAAGACGAAGAGGAAAACGATAGCGAGGAGAATGATGAGTCCGATTCCTAA
Protein Sequence: MSDTEVVEPKKGRGRPSNPEKNSVAPKKRARAASPKDKAEEKDKALASDEEPSAKRGRGRPKGTAKKAPKAKKPDTKKGRGRGKKKPAKDESSEEEEDDEDEEENDSEENDESDS

Sequence clustering based on sequence similarity using MMseqs2