Basic Information

Transcription Factor Domain

TF Family: BTB
Domain: zf-C2H2|ZBTB
PFAM: PF00651
TF Group: Zinc-Coordinating Group
Description: The BTB (for BR-C, ttk and bab) [6] or POZ (for Pox virus and Zinc finger) [1] domain is present near the N-terminus of a fraction of zinc finger (Pfam:PF00096) proteins and in proteins that contain the Pfam:PF01344 motif such as Kelch and a family of pox virus proteins. The BTB/POZ domain mediates homomeric dimerisation and in some instances heteromeric dimerisation [1]. The structure of the dimerised PLZF BTB/POZ domain has been solved and consists of a tightly intertwined homodimer. The central scaffolding of the protein is made up of a cluster of alpha-helices flanked by short beta-sheets at both the top and bottom of the molecule [2]. POZ domains from several zinc finger proteins have been shown to mediate transcriptional repression and to interact with components of histone deacetylase co-repressor complexes including N-CoR and SMRT [5, 3, 4]. The POZ or BTB domain is also known as BR-C/Ttk or ZiN.
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 4 0.078 32 5.6 0.0 83 109 18 44 13 45 0.91

2 4 6.6 2.7e+03 -0.6 0.0 80 107 47 74 42 76 0.84

3 4 3.6e-17 1.5e-14 54.9 0.0 9 97 138 226 134 241 0.83

4 4 5.1 2.1e+03 -0.3 0.0 78 102 241 265 229 272 0.75

#	of	c-Evalue	i-Evalue	score	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	4	0.078	32	5.6	83	109	18	44	13	45	0.91
2	4	6.6	2.7e+03	-0.6	80	107	47	74	42	76	0.84
3	4	3.6e-17	1.5e-14	54.9	9	97	138	226	134	241	0.83
4	4	5.1	2.1e+03	-0.3	78	102	241	265	229	272	0.75

Coding Sequence: ATGTTACGGACTACAGATGAGAATCCTGCCTGCCCGGCGACTATTCTACTCGTGATAGAAGTGCTACGGCTAGCGTTAAAACTTAGCATACCCCGCCTACGCGGTCTGTGCTCCCGGTACCTCCGCTCCAATCTGTGCTATAGCAATGTGTTAGCCGCTTTACATGCAGCTCATAACGCTAACTTGGCTTGTATTAAGGAACATTGTCTCAGGTTTGTAGTGAAGGACTACAACTTCACGCCGATAGTGATGTCAATAGACTTTGAGAATATGGAACAGTCGCTTATGGTGGAAGTTATAAGACGCCGTCAGCAACCGCCTCCGAAACAACCGCAGCACGAAACCGATGAGGACATACAAGGGACAACACTCGAACAAGATATGTGCGTTTTCGTCAGCGGTGGGGGCGCGGAATTGAGCGACGTGAAGTTGATTGTAGGCTCAACGTACCGTCCGGCTCACCGGTCGATATTAGCTGCGCGTGCTGCCTATTTCGAAGCTATGTTCAGATCGTTTTCACCTCCCGACGACACCGTCAATATACAAATATGTGACACCGTGCCATCGGAGGAAGCGTTCGACTCGCTTCTGCGCTACATATACTATGGAGACACAAACATGCCCACTGAGGACTCATTGTATCTGTTCCAAGCGCCAATATACTATGGTTTCACAAACAACCGACTCCAAGTGTTCTGCAAACACAACCTTCAGAGCAACGTGTCTTGTGAGAACGTTTTGCCGATTTTACAAGCGGCGGATCGCATGAGAGCAATAGACATCAAGGAGTATGCGCTCAAAATGATCGTACATCATTTTACTATGGTAGCCCGCCAAGATTCGGTGAAGAATCTCCCACAATCGCTATTAGTGGACATCTTGCAAGCATTAGCAGAAGAGCCACGTTATGACATACCTCTGCCTTTACAACCGCGTTCGCTCCCTACTTCGGCATCAGCGGATACTCTCACCGATGACACAGATTACAAACATCAACATAAACAAGGAAAATGTTAG
Protein Sequence: MLRTTDENPACPATILLVIEVLRLALKLSIPRLRGLCSRYLRSNLCYSNVLAALHAAHNANLACIKEHCLRFVVKDYNFTPIVMSIDFENMEQSLMVEVIRRRQQPPPKQPQHETDEDIQGTTLEQDMCVFVSGGGAELSDVKLIVGSTYRPAHRSILAARAAYFEAMFRSFSPPDDTVNIQICDTVPSEEAFDSLLRYIYYGDTNMPTEDSLYLFQAPIYYGFTNNRLQVFCKHNLQSNVSCENVLPILQAADRMRAIDIKEYALKMIVHHFTMVARQDSVKNLPQSLLVDILQALAEEPRYDIPLPLQPRSLPTSASADTLTDDTDYKHQHKQGKC

Sequence clustering based on sequence similarity using MMseqs2