Imas013877.1
Basic Information
- Insect
- Incurvaria masculella
- Gene Symbol
- -
- Assembly
- GCA_946894085.1
- Location
- CAMPPJ020000126.1:1439115-1443658[-]
Transcription Factor Domain
- TF Family
- zf-GAGA
- Domain
- zf-GAGA domain
- PFAM
- PF09237
- TF Group
- Zinc-Coordinating Group
- Description
- Members of this family bind to a 5'-GAGAG-3' DNA consensus binding site, and contain a Cys2-His2 zinc finger core as well as an N-terminal extension containing two highly basic regions. The zinc finger core binds in the DNA major groove and recognises the first three GAG bases of the consensus in a manner similar to that seen in other classical zinc finger-DNA complexes. The second basic region forms a helix that interacts in the major groove recognising the last G of the consensus, while the first basic region wraps around the DNA in the minor groove and recognises the A in the fourth position of the consensus sequence [1].
- Hmmscan Out
-
# of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc 1 4 0.2 7.1e+03 -1.8 0.0 19 43 34 58 26 63 0.65 2 4 4.5e-08 0.0015 19.5 0.3 20 46 63 89 56 97 0.89 3 4 0.00069 24 6.1 0.1 25 53 97 125 89 126 0.84 4 4 0.0038 1.3e+02 3.7 0.0 24 44 125 145 121 151 0.87
Sequence Information
- Coding Sequence
- ATGGCGTACGCCAGGACATCTCAAGGTGCCCGAAGACGCCAATGGGATATCGAATTTACAGGGGGGCTGCGAAAACCATGCCGGCCGGCCAGAACGATTCACCAAAATATATTTCCCTTCAAGTGCGACCTGTGCCAGTACCGGGGCAAGACCGCCGGATTGCTGAGGACGCACAGGAAGATCCACTTCTCGGAGAAGCCGCACGCTTGCTCCATGTGCCCGAAGGCGTTTCGAACTTCCAGCAATCTCCGGAAACACCTGCAGGTGCACAAGGGCCAGCAGGAAGCTGTGCAGTGCTCGCTCTGCGATAAGACTCTACGCAACAAAGAAACGCTGCGCGGGCACGTGAGCTCGGTGCACGCCAACCGACCGCCCGTCACCTGCAACCTTTGCGGCAAACTCTTCAAGGGCATGCGAGCACTCTACAAGCACCGCAGCAAAGTGCACAACTGGCGCGCCGAGTACACGGGTCGCCTGCCCGCGTACATGCTCTGCCAGCCCGAGGAGCCAGAGACTTCGCCGGCGCCCCCGCTTCCGGAGCACGCGACGCACCAACCGGGCCTCCCTGATCAGTGA
- Protein Sequence
- MAYARTSQGARRRQWDIEFTGGLRKPCRPARTIHQNIFPFKCDLCQYRGKTAGLLRTHRKIHFSEKPHACSMCPKAFRTSSNLRKHLQVHKGQQEAVQCSLCDKTLRNKETLRGHVSSVHANRPPVTCNLCGKLFKGMRALYKHRSKVHNWRAEYTGRLPAYMLCQPEEPETSPAPPLPEHATHQPGLPDQ
Similar Transcription Factors
Sequence clustering based on sequence similarity using MMseqs2
- 100% Identity
- iTF_00839852;
- 90% Identity
- iTF_00839852;
- 80% Identity
- iTF_00839852;