Basic Information

Transcription Factor Domain

TF Family: BTB
Domain: zf-C2H2|ZBTB
PFAM: PF00651
TF Group: Zinc-Coordinating Group
Description: The BTB (for BR-C, ttk and bab) [6] or POZ (for Pox virus and Zinc finger) [1] domain is present near the N-terminus of a fraction of zinc finger (Pfam:PF00096) proteins and in proteins that contain the Pfam:PF01344 motif such as Kelch and a family of pox virus proteins. The BTB/POZ domain mediates homomeric dimerisation and in some instances heteromeric dimerisation [1]. The structure of the dimerised PLZF BTB/POZ domain has been solved and consists of a tightly intertwined homodimer. The central scaffolding of the protein is made up of a cluster of alpha-helices flanked by short beta-sheets at both the top and bottom of the molecule [2]. POZ domains from several zinc finger proteins have been shown to mediate transcriptional repression and to interact with components of histone deacetylase co-repressor complexes including N-CoR and SMRT [5, 3, 4]. The POZ or BTB domain is also known as BR-C/Ttk or ZiN.
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 3 2.3e-19 1.4e-16 60.2 0.1 9 109 13 109 5 110 0.93

2 3 6.9 4.2e+03 -2.5 0.0 98 108 150 160 124 162 0.72

3 3 9.8 5.9e+03 -3.0 0.0 79 102 163 186 154 193 0.65

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	3	2.3e-19	1.4e-16	60.2	0.1	9	109	13	109	5	110	0.93
2	3	6.9	4.2e+03	-2.5	0.0	98	108	150	160	124	162	0.72
3	3	9.8	5.9e+03	-3.0	0.0	79	102	163	186	154	193	0.65

Coding Sequence: ATGTCATCAACTGAAGATTTAGAGTTAAACGATCCCAATACAAGTGATCTTGTACTTTTAGTTCATGGAACTCGAATTTATGCACATCGAGAGTATCTCAGTCGTAAATCGGAACGTTTCGCGGCACTTCTCTCCGATCGGTGGGCAAACCAAAAAGAGGTGGAAATCACCGAATATGACTACGAAACCATCATTTCCTATCTTCAGTTTCTCTACACCGAAGAGATTGAGTTCACCTGGGAGAATATCGAATCACTGTACGATCTCTCGGTGGGATACTGTGAAAATTCATTGAAAATCCAATGTCAAAAATATCTTGAAGAACAGGGAATTCTGGATCCAGAGCAATATTACGAATTCTCGGATCGAATTCGTCTTCTATTCTCCTCATCGGTTGCAATCACCGTTGCAAATGTGACACAATTGTATTCTCACCCCGAGACTGGTTTTCGTGAACAATGCGATGAGTTTTTGAAGAATCAAATTGGAACCGAGAATATGCTTCGATGCTGTGAGATTGTGAATCAATTGGAGCGGCCTCACTTGGTAGACTATTACCGAGAGTGGACGCAAAAACAGGAACTCACACTGGACAACTGTTTTGCACTGTTTGACTTCACTGTTGAGTTGAAAATGCTTGACTTAAGGGATAGAGT
Protein Sequence: MSSTEDLELNDPNTSDLVLLVHGTRIYAHREYLSRKSERFAALLSDRWANQKEVEITEYDYETIISYLQFLYTEEIEFTWENIESLYDLSVGYCENSLKIQCQKYLEEQGILDPEQYYEFSDRIRLLFSSSVAITVANVTQLYSHPETGFREQCDEFLKNQIGTENMLRCCEIVNQLERPHLVDYYREWTQKQELTLDNCFALFDFTVELKMLDLRDR

Sequence clustering based on sequence similarity using MMseqs2