Basic Information

Transcription Factor Domain

TF Family: BTB
Domain: zf-C2H2|ZBTB
PFAM: PF00651
TF Group: Zinc-Coordinating Group
Description: The BTB (for BR-C, ttk and bab) [6] or POZ (for Pox virus and Zinc finger) [1] domain is present near the N-terminus of a fraction of zinc finger (Pfam:PF00096) proteins and in proteins that contain the Pfam:PF01344 motif such as Kelch and a family of pox virus proteins. The BTB/POZ domain mediates homomeric dimerisation and in some instances heteromeric dimerisation [1]. The structure of the dimerised PLZF BTB/POZ domain has been solved and consists of a tightly intertwined homodimer. The central scaffolding of the protein is made up of a cluster of alpha-helices flanked by short beta-sheets at both the top and bottom of the molecule [2]. POZ domains from several zinc finger proteins have been shown to mediate transcriptional repression and to interact with components of histone deacetylase co-repressor complexes including N-CoR and SMRT [5, 3, 4]. The POZ or BTB domain is also known as BR-C/Ttk or ZiN.
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 3 0.0008 0.15 12.3 0.0 4 33 21 49 18 50 0.88

2 3 1.1e-06 0.0002 21.6 0.1 66 109 49 95 48 96 0.94

3 3 0.004 0.77 10.1 0.1 81 109 99 127 93 128 0.88

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	3	0.0008	0.15	12.3	0.0	4	33	21	49	18	50	0.88
2	3	1.1e-06	0.0002	21.6	0.1	66	109	49	95	48	96	0.94
3	3	0.004	0.77	10.1	0.1	81	109	99	127	93	128	0.88

Coding Sequence: ATGAGCACCCAGGAAAACAATACCGACGACATTATCGGCTTCGCAACGGACATAGGCAGTCTCTTCATGAACGAGCTCTACTCGGACGTGGAGTTCTTGGTGGAGGATCAGCGCTTGCCAGGTCACCGCTACCTTTTGGCGGTGCGCATCCTCGAGTACCTTTACTCGGGCAAGTTACCTCTTTCCACACTGGATGTTGACAAGATAGTCGATGTGCTCGATTTGGCGCATCTTTACGGCTTGGAGTACGTTGAGACGGCTATAACCGAACATCTACAGAAGAGTATTGCCGTCAGCAACGTGTGCGTGATCCTGAATGCAGCGCGCCGATACGATCTGGACCAGGTGACAAGAGAATGCCTGCAGTTTATGGACAACAATGTGGTCGATCTACTTAAACACGACTCCATCCAAATGGTGTCCAAGGAGTCATTTGAGGAGGTGTTGCGCCGAGACAGCTTCTGTGTTCCTGAAGTGGAAATCTTTCGGTCTGTATGCAAATGGAGGGACAACAATCCGAGGGAGGACATGAGGACATGA
Protein Sequence: MSTQENNTDDIIGFATDIGSLFMNELYSDVEFLVEDQRLPGHRYLLAVRILEYLYSGKLPLSTLDVDKIVDVLDLAHLYGLEYVETAITEHLQKSIAVSNVCVILNAARRYDLDQVTRECLQFMDNNVVDLLKHDSIQMVSKESFEEVLRRDSFCVPEVEIFRSVCKWRDNNPREDMRT

Sequence clustering based on sequence similarity using MMseqs2