Basic Information

Transcription Factor Domain

TF Family: BTB
Domain: zf-C2H2|ZBTB
PFAM: PF00651
TF Group: Zinc-Coordinating Group
Description: The BTB (for BR-C, ttk and bab) [6] or POZ (for Pox virus and Zinc finger) [1] domain is present near the N-terminus of a fraction of zinc finger (Pfam:PF00096) proteins and in proteins that contain the Pfam:PF01344 motif such as Kelch and a family of pox virus proteins. The BTB/POZ domain mediates homomeric dimerisation and in some instances heteromeric dimerisation [1]. The structure of the dimerised PLZF BTB/POZ domain has been solved and consists of a tightly intertwined homodimer. The central scaffolding of the protein is made up of a cluster of alpha-helices flanked by short beta-sheets at both the top and bottom of the molecule [2]. POZ domains from several zinc finger proteins have been shown to mediate transcriptional repression and to interact with components of histone deacetylase co-repressor complexes including N-CoR and SMRT [5, 3, 4]. The POZ or BTB domain is also known as BR-C/Ttk or ZiN.
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 3 4e-22 1.1e-19 70.5 0.4 3 106 11 116 9 120 0.93

2 3 2.5 7.2e+02 0.3 0.0 79 107 124 152 118 154 0.81

3 3 3.2 9.2e+02 -0.1 0.1 45 71 258 284 251 295 0.78

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	3	4e-22	1.1e-19	70.5	0.4	3	106	11	116	9	120	0.93
2	3	2.5	7.2e+02	0.3	0.0	79	107	124	152	118	154	0.81
3	3	3.2	9.2e+02	-0.1	0.1	45	71	258	284	251	295	0.78

Coding Sequence: ATGGATACTTGGCTAAAACCAGTCTTTGCCGATTTGATAGAGAACAAGAAGTTCTCAGACTGCCGCATTCTCGTGGAAAACGAAGCCTTTGATTGCCACAAGGTCATCCTGGCCAGCTCGTCCAAGTTTTTCGAGCGCCTATTCCTGGGCTCCTTCCGGGAGTCCGAGTCGTGCGAAATTCGTCTTCAGGAGGTTAAGCCGGCAACCTTCGCCATGTTCATTCAATTTGCGTACACCTACAGTATTAAGAATCTTAATAAGTGCAACAATTCCATGTTAACGGAGCTTATCAGCTGCGGAACCAGGTGGCTGGTGGATTCTCTCGTTTCCGGATGCGCGAAAATCCTCAGTATGCGTGCTAATACTATGCAGCTCAGCGATCTGGTCCAGCTGTTCCAGAGCGCGCATAGCATCAACCTCAAGGAACTGATAGACCATTCCGTCAACGCTTTGACAAACCGCTTTCGTACATCAATGAATTGCTATGATGTTCTGACCTTGACCTCCGATGTATTCGAGCAGTACACAATCATAACCGAGGACTGCTTGTCCGAGATCGAAAGGTTCAAAATGATCGAGGCCTACATTACTGTAAATGGCTTGATCGATTCCGACCCAGCAGAGACCTCGGAGGTTGAAGTAAGCCCTAAAAAAGAGGGTGACAGTGGCATTGATGAGTTGGCGGTCGCAAAAAAACGGACCGACGACAACGAGCAAAAGTCTTCCGAGAATGGAGAACCTCCGGAATTAAGTGTCAAATCAGAGGACAACGAAGAGAATGAGGAGGAGTCAAAGAATACAAAAATTGAAAAACTGCACTTAAAATATGTAAAAACGCTTCTTGGCTACATAAGATTCAATAAGATGACAAAAAATGACTTTTACAACATCGTTGGCAAGTCTCCATTGTTGACCACGAAGGAGAAATACGAAAATATGTACTTAACTATTTGCGGCAGTTGTAATTGTTAA
Protein Sequence: MDTWLKPVFADLIENKKFSDCRILVENEAFDCHKVILASSSKFFERLFLGSFRESESCEIRLQEVKPATFAMFIQFAYTYSIKNLNKCNNSMLTELISCGTRWLVDSLVSGCAKILSMRANTMQLSDLVQLFQSAHSINLKELIDHSVNALTNRFRTSMNCYDVLTLTSDVFEQYTIITEDCLSEIERFKMIEAYITVNGLIDSDPAETSEVEVSPKKEGDSGIDELAVAKKRTDDNEQKSSENGEPPELSVKSEDNEENEEESKNTKIEKLHLKYVKTLLGYIRFNKMTKNDFYNIVGKSPLLTTKEKYENMYLTICGSCNC

Sequence clustering based on sequence similarity using MMseqs2