Basic Information

Transcription Factor Domain

TF Family: zf-GAGA
Domain: zf-GAGA domain
PFAM: PF09237
TF Group: Zinc-Coordinating Group
Description: Members of this family bind to a 5'-GAGAG-3' DNA consensus binding site, and contain a Cys2-His2 zinc finger core as well as an N-terminal extension containing two highly basic regions. The zinc finger core binds in the DNA major groove and recognises the first three GAG bases of the consensus in a manner similar to that seen in other classical zinc finger-DNA complexes. The second basic region forms a helix that interacts in the major groove recognising the last G of the consensus, while the first basic region wraps around the DNA in the minor groove and recognises the A in the fourth position of the consensus sequence [1].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 2 1.5e-12 1.1e-08 36.8 0.0 20 51 12 43 2 46 0.89

2 2 0.58 4.1e+03 -0.2 4.5 14 25 128 139 113 142 0.89

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	2	1.5e-12	1.1e-08	36.8	0.0	20	51	12	43	2	46	0.89
2	2	0.58	4.1e+03	-0.2	4.5	14	25	128	139	113	142	0.89

Coding Sequence: ATGGAAAATCCAGCTTCAATACCGAAGAAACTAGTGTCAGATCAACCAGTAGAATGTTCTATTTGTGGGGTAGTCTTAAAACAATCTAGAAATCTTAGACGACACATGTCTTTGATTCATATGAAAGATTCTGGGGGAACAAAAAGGCAGAAAAAACATGCAGAGAAAATTAGAAAAGAAGGAGGTGTGACTACAGATGGTAGTGAAACAGATAATAGTGGGTCATCAAATGCTACATTATTAAGAACTTCTACACCACAAATATCTATGCCATCGATTGGAATATTACCAATGTATCCTCCAACAGAAGAAGTTTCATCCATGGTTTCAGAAATACAACAATCACAGTCCGATTCTCAACCGCTTCAATCATCACCAACATCTCCATCTTCTCAGTCTCAGTCACAGCAACCATTGTCTTCACAAGATCAGATGGATGTTCCAGTACCAGGGACATCAACCTCATTATGTGATAATATAAATACATCATTTGTACCAACTAGTATGCATCATACCATGCAATTTACCCATGACAGTTTATTTAGACAACATCAAAATGAGTTGATTCGTAATGCTTCTCTTTATAATGTTACCGATAGTAGAGAACATTGTGCCAACGACTGA
Protein Sequence: MENPASIPKKLVSDQPVECSICGVVLKQSRNLRRHMSLIHMKDSGGTKRQKKHAEKIRKEGGVTTDGSETDNSGSSNATLLRTSTPQISMPSIGILPMYPPTEEVSSMVSEIQQSQSDSQPLQSSPTSPSSQSQSQQPLSSQDQMDVPVPGTSTSLCDNINTSFVPTSMHHTMQFTHDSLFRQHQNELIRNASLYNVTDSREHCAND

Sequence clustering based on sequence similarity using MMseqs2