Basic Information

Transcription Factor Domain

TF Family: PAX
Domain: PAX domain
PFAM: PF00292
TF Group: Helix-turn-helix
Description: The paired domain, a ~126 amino acid DNA-binding domain, is found in eukaryotic transcription regulatory proteins involved in embryogenesis. Initially identified in Drosophila’s paired (prd) protein, it typically resides in the N-terminal region and may be followed by an octapeptide, a homeodomain, or a Pro-Ser-Thr-rich C terminus. Paired domain proteins act as transcription repressors or activators, with DNA-binding specificity mediated by three subdomains. Crystal structures reveal a bipartite DNA-binding paired domain: an N-terminal subdomain (PAI) and a C-terminal subdomain (RED), linked by a flexible linker. Both subdomains contain a helix-turn-helix motif that binds DNA's major groove, while the linker may bind the minor groove. Variations in domain usage across Pax proteins and isoforms determine sequence specificity.
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 2 1e-06 0.0026 19.3 0.0 24 61 9 46 1 80 0.90

2 2 3.5e-05 0.088 14.3 0.3 42 79 112 148 96 204 0.83

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	2	1e-06	0.0026	19.3	0.0	24	61	9	46	1	80	0.90
2	2	3.5e-05	0.088	14.3	0.3	42	79	112	148	96	204	0.83

Coding Sequence: ATGCCAGAAAAAGCAATAAGAGCTAGTAAAATTATAGCGCTGCTGGAAGAGGGGTGCAGCCAATGTTACGTCTCACAGCGGTTAAACGTGAGTCGTTCAACCGTCCAAAGAACCTGGACTCGATACCAAGAGACAGAACCTGGACTCGATACCAAGAGACAGGTTAAACGTGAGTCGTTCAACCGTCCAAAGAACCTGGACTCGATACCAACCAAGAGACAGGTTAAACGTGAGTCGTTCAACCGTCCAAAGAACCTGGACTCGATACCAAGAGACAGGTTTAAACGTGAGTCGTTCAACCGTCCAAAGAACCTGGACTCGATACCAAGAGACAGGTTAAACGTGAGTCGTTCAACCGTCCAAAGAACCTGGACTCGATACCAAGAGACAGGTTCCGTTCAGAGAAGGCAAGGTTCTGGGAGAAATCGTTGCACACAACCACGAGACGACCACTTTATAGTGAGTCAGGCGCTGAGGAACCGCAAATGCAGTTACATAGACCTCAAAAGAAACCTTGAAGAGGTACGACGAGCACAAGTTAGCCTATGGACTGTGAGGAGGAGGCTTTTAGCGGCTGATATACACAGTCGACGACCAGCGCGGGCCCCCAAGTTACTCCGTGAGCACCGGGCGGGTTGCTCGATTGAGGTTCGCTAG
Protein Sequence: MPEKAIRASKIIALLEEGCSQCYVSQRLNVSRSTVQRTWTRYQETEPGLDTKRQVKRESFNRPKNLDSIPTKRQVKRESFNRPKNLDSIPRDRFKRESFNRPKNLDSIPRDRLNVSRSTVQRTWTRYQETGSVQRRQGSGRNRCTQPRDDHFIVSQALRNRKCSYIDLKRNLEEVRRAQVSLWTVRRRLLAADIHSRRPARAPKLLREHRAGCSIEVR

Sequence clustering based on sequence similarity using MMseqs2