Basic Information

Transcription Factor Domain

TF Family: zf-GAGA
Domain: zf-GAGA domain
PFAM: PF09237
TF Group: Zinc-Coordinating Group
Description: Members of this family bind to a 5'-GAGAG-3' DNA consensus binding site, and contain a Cys2-His2 zinc finger core as well as an N-terminal extension containing two highly basic regions. The zinc finger core binds in the DNA major groove and recognises the first three GAG bases of the consensus in a manner similar to that seen in other classical zinc finger-DNA complexes. The second basic region forms a helix that interacts in the major groove recognising the last G of the consensus, while the first basic region wraps around the DNA in the minor groove and recognises the A in the fourth position of the consensus sequence [1].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 6 0.042 8.9e+02 2.6 0.3 24 46 50 71 37 75 0.78

2 6 0.018 3.9e+02 3.7 2.0 21 43 75 97 72 103 0.79

3 6 0.0013 29 7.4 0.1 21 43 103 125 99 130 0.91

4 6 9.4e-07 0.02 17.5 0.5 21 45 131 155 126 166 0.86

5 6 0.061 1.3e+03 2.1 0.0 21 42 187 208 179 214 0.77

6 6 2e-05 0.43 13.2 0.1 21 46 215 240 208 246 0.90

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	6	0.042	8.9e+02	2.6	0.3	24	46	50	71	37	75	0.78
2	6	0.018	3.9e+02	3.7	2.0	21	43	75	97	72	103	0.79
3	6	0.0013	29	7.4	0.1	21	43	103	125	99	130	0.91
4	6	9.4e-07	0.02	17.5	0.5	21	45	131	155	126	166	0.86
5	6	0.061	1.3e+03	2.1	0.0	21	42	187	208	179	214	0.77
6	6	2e-05	0.43	13.2	0.1	21	46	215	240	208	246	0.90

Coding Sequence: ATGTTGTGTTACAGGGCCTTGTCGGTGGTTTCCCCTGACCAGTTGGCGGCAGTGGCCGAGAGCAGCTTGGCCACCGACCCTGCGTTGTTCCCAATCACCCTGTGTGAAGCGGTCTACAAGAAGAGGTGCGCCCCGGAGGGACCCAGGAGCTTCACGTGCTCCACGTGCGGGGGCCAGTACAAGCGACGGGAGTCCCTGAAGAGGCACCTGCTGAAGCACAGCGGAGAGAAGCCCTTCGCCTGCCCCGTGTGCAGCCTGCAGTTCTGCCGCAAGTGCCAGCTGACGCGCCACGCCCTGGTGCACACGTGCGAGAAGCCCCACGCCTGCGCCGACTGCGGCGCAAGGTTCCGCGACCGGGGCAACCTCCGCACGCACCGGCTGGTGCACACGGGCGAGAAGCCCTTCCAGTGCCCGGAGTGCGGGGCGCGCTTCCGGGACCGCAGCAACCTCAGGAGGCACCTGCTCACGCACGGCGCGGCCAGGCGCTTCGCCTGCGTCGCCTGCGCGGCCCGGTTCAAGCGCAAGGGCGACCTGAAGACGCACGCGCTCACCCACACGGGCGAGAAGCCCTTCTCGTGCCACGTGTGCGGCACGGGGTTCGTGGTGAGGAGCAGCCTCAACAAGCACCTGTTCACCCACACGGGGGAGAAGCCCTTCCAGTGCCCGGACTGCGGCGTGGCCTTCCAGCAGCTGCGGTACCTCAGGAGGCACTCTGCGCTGCACGCCGGCGACCAGCCCCTCGACTTCTCCCTCCGCTGA
Protein Sequence: MLCYRALSVVSPDQLAAVAESSLATDPALFPITLCEAVYKKRCAPEGPRSFTCSTCGGQYKRRESLKRHLLKHSGEKPFACPVCSLQFCRKCQLTRHALVHTCEKPHACADCGARFRDRGNLRTHRLVHTGEKPFQCPECGARFRDRSNLRRHLLTHGAARRFACVACAARFKRKGDLKTHALTHTGEKPFSCHVCGTGFVVRSSLNKHLFTHTGEKPFQCPDCGVAFQQLRYLRRHSALHAGDQPLDFSLR

Sequence clustering based on sequence similarity using MMseqs2