Basic Information

Transcription Factor Domain

TF Family: zf-GAGA
Domain: zf-GAGA domain
PFAM: PF09237
TF Group: Zinc-Coordinating Group
Description: Members of this family bind to a 5'-GAGAG-3' DNA consensus binding site, and contain a Cys2-His2 zinc finger core as well as an N-terminal extension containing two highly basic regions. The zinc finger core binds in the DNA major groove and recognises the first three GAG bases of the consensus in a manner similar to that seen in other classical zinc finger-DNA complexes. The second basic region forms a helix that interacts in the major groove recognising the last G of the consensus, while the first basic region wraps around the DNA in the minor groove and recognises the A in the fourth position of the consensus sequence [1].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 10 9e-05 0.9 11.1 0.1 21 44 6 29 2 38 0.89

2 10 0.022 2.2e+02 3.5 0.1 26 45 39 58 32 64 0.87

3 10 0.17 1.7e+03 0.6 0.0 26 48 66 87 58 92 0.81

4 10 0.0069 69 5.1 0.0 21 44 117 140 112 144 0.84

5 10 0.00069 6.9 8.3 0.1 21 45 145 169 141 172 0.87

6 10 0.0012 12 7.6 0.0 21 45 173 197 169 205 0.89

7 10 0.36 3.6e+03 -0.4 0.1 26 44 206 224 197 233 0.83

8 10 0.0012 12 7.6 0.3 21 44 257 280 249 285 0.83

9 10 0.028 2.8e+02 3.1 0.3 20 44 284 308 280 312 0.78

10 10 0.002 20 6.8 0.1 21 44 313 336 309 341 0.85

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	10	9e-05	0.9	11.1	0.1	21	44	6	29	2	38	0.89
2	10	0.022	2.2e+02	3.5	0.1	26	45	39	58	32	64	0.87
3	10	0.17	1.7e+03	0.6	0.0	26	48	66	87	58	92	0.81
4	10	0.0069	69	5.1	0.0	21	44	117	140	112	144	0.84
5	10	0.00069	6.9	8.3	0.1	21	45	145	169	141	172	0.87
6	10	0.0012	12	7.6	0.0	21	45	173	197	169	205	0.89
7	10	0.36	3.6e+03	-0.4	0.1	26	44	206	224	197	233	0.83
8	10	0.0012	12	7.6	0.3	21	44	257	280	249	285	0.83
9	10	0.028	2.8e+02	3.1	0.3	20	44	284	308	280	312	0.78
10	10	0.002	20	6.8	0.1	21	44	313	336	309	341	0.85

Coding Sequence: ATGGTAAAACATACTGGGGAGAAGCCGCATAAGTGCACTGTTTGTAAATACGCCACGTCACAATCAAGCAATCTCAAAAAGCATATGATAACACATACAGGAGACAAACGGCATATGTGCAGTCTGTGTGACTATACTTCTGCACAATCAAACCATCTTAAACGTCATATGTCACAACACACAGGGGAGAAGTATAACTGCAGTGAGTGCGACTATGTTGCAAACAAAACATCCAATCTCAAAAAACATACACTAAAACATACTGGAGGAAAACCTTTTAGGTGTGATCTGTGCGAATATGCTAGCACAAAAGCGTCTGATCTTAACGCACATATTCTAAAACACAACGGAGAGAAGCCGATTAAGTGCGATATGTGCGATTACGCAACCACGCAAGCGTCGTCTCTTAAAAAACATATGCTCAAACACACAGGCGAAAAACCGTATAAGTGCGTTATGTGCGATTATGCTGTTGCGCAATCGTACCTTCTTAAACGTCATATGCATCAACATACAGGGGAAAAGCCATATAAGTGCACGCTTTGCGATTACGCTGCCCGGCAATCAGGAAGTCTTAAACTCCATATGCAAAAACATACGGGGGAGATGCGTTATAACTGTTCGATGTGCGATTGTGGTTTTGCGCAAGCCAGCCATTATAAACGTCATATGCTAGTACATACGGGTGATAGGCCGTTTAAGTGCGCAACGTGTGACTATGCTTCCGTCGAAGCGTATCAGCTTAAAGTGCATAGCATGAAACATTCCGGCGAGAAGCCTTTTAAATGTAGTGTGTGCGATTATGCTACGATACGATCGCGTCATCTTACGTGTCATATGATGAAACATAGAGGGGAGAAACCGTATAAGTGCACTGTGTGTGATTATGCTGCCTGTGCATCGTCTCAGCTTAAACAACATATTCTAAAACATACCGGCGAGAAACCACATAAGTGCGCTGTTTGTGTTTATGCTACGACACAGATAAGCAAACTTAAACGTCATATGCTCACACATGCAGGGCATTCTTAG
Protein Sequence: MVKHTGEKPHKCTVCKYATSQSSNLKKHMITHTGDKRHMCSLCDYTSAQSNHLKRHMSQHTGEKYNCSECDYVANKTSNLKKHTLKHTGGKPFRCDLCEYASTKASDLNAHILKHNGEKPIKCDMCDYATTQASSLKKHMLKHTGEKPYKCVMCDYAVAQSYLLKRHMHQHTGEKPYKCTLCDYAARQSGSLKLHMQKHTGEMRYNCSMCDCGFAQASHYKRHMLVHTGDRPFKCATCDYASVEAYQLKVHSMKHSGEKPFKCSVCDYATIRSRHLTCHMMKHRGEKPYKCTVCDYAACASSQLKQHILKHTGEKPHKCAVCVYATTQISKLKRHMLTHAGHS

Sequence clustering based on sequence similarity using MMseqs2