Basic Information

Transcription Factor Domain

TF Family: HMGA
Domain: HMGA domain
PFAM: AnimalTFDB
TF Group: Unclassified Structure
Description: This entry represents the HMGA family, whose members contain DNA-binding domains, also known as AT hooks due to their ability to interact with the narrow minor groove of AT-rich DNA sequences. They play an important role in chromatin organisation [1]. The high mobility group (HMG) proteins are the most abundant and ubiquitous nonhistone chromosomal proteins. They bind to DNA and to nucleosomes and are involved in the regulation of DNA-dependent processes such as transcription, replication, recombination, and DNA repair. They can be grouped into three families: HMGB (HMG 1/2), HMGN (HMG 14/17) and HMGA (HMG I/Y). The characteristic domains are: AT-hook for the HMGA family, the HMG Box for the HMGB family, and the nucleosome-binding domain (NBD) for the members of the HMGN family [2].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 3 0.00085 13 5.3 1.2 4 15 5 16 3 17 0.83

2 3 8.7e-11 1.4e-06 27.7 2.5 4 21 57 74 54 75 0.86

3 3 0.67 1e+04 -3.9 4.9 12 18 89 95 88 98 0.58

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	3	0.00085	13	5.3	1.2	4	15	5	16	3	17	0.83
2	3	8.7e-11	1.4e-06	27.7	2.5	4	21	57	74	54	75	0.86
3	3	0.67	1e+04	-3.9	4.9	12	18	89	95	88	98	0.58

Coding Sequence: ATGTCCGATACGGAGGTCGTTGAACCTAAGAAGGGTCGCGGACGTCCACCCAACGTCGAAAGGAACAGCGTGGCCCCGAAAAAGCGTGCCCGAGCCCTCTCCCCGAAGGACACCAAAGACGAAGAGAAGGAGCGCGAGAAGGAAAAGGCTGTCGTTTCGGATGCCGATGATGAACCGTCACCGAAGCGTGGCCGCGGACGGCCAAAAGGCACCGCAAAGAAGACCACTAAGGCCCCCAAAAAGGCACCGGTTGCTCCGGTCGGCCGTGGCCGTGGTCGGGGAAAGAAAAAGGCGGCCGAATCGTCGGACGAGGATGATGATGACGAAGATCCGGAGGACAGCGATGAAAATGAGGAAAACTACGAAAACGATGACTCTGATTAA
Protein Sequence: MSDTEVVEPKKGRGRPPNVERNSVAPKKRARALSPKDTKDEEKEREKEKAVVSDADDEPSPKRGRGRPKGTAKKTTKAPKKAPVAPVGRGRGRGKKKAAESSDEDDDDEDPEDSDENEENYENDDSD

Sequence clustering based on sequence similarity using MMseqs2