Basic Information

Gene Symbol
-
Assembly
None
Location
GWHAMMQ00001887:23214-25867[+]

Transcription Factor Domain

TF Family
zf-GAGA
Domain
zf-GAGA domain
PFAM
PF09237
TF Group
Zinc-Coordinating Group
Description
Members of this family bind to a 5'-GAGAG-3' DNA consensus binding site, and contain a Cys2-His2 zinc finger core as well as an N-terminal extension containing two highly basic regions. The zinc finger core binds in the DNA major groove and recognises the first three GAG bases of the consensus in a manner similar to that seen in other classical zinc finger-DNA complexes. The second basic region forms a helix that interacts in the major groove recognising the last G of the consensus, while the first basic region wraps around the DNA in the minor groove and recognises the A in the fourth position of the consensus sequence [1].
Hmmscan Out
# of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc
1 5 0.01 0.82 9.8 0.0 26 44 92 110 81 114 0.90
2 5 0.0023 0.18 11.9 0.1 21 46 115 140 111 146 0.86
3 5 4.9 3.9e+02 1.3 0.0 21 45 143 167 139 176 0.81
4 5 3.7 2.9e+02 1.7 0.0 21 47 171 197 167 202 0.83
5 5 0.0016 0.13 12.4 0.1 21 45 199 223 195 229 0.90

Sequence Information

Coding Sequence
ATGAAAACTTGTGCAATAAAAGAAGAAAAAATCGAAATTATTGACGAATCAAAACCAGAATTCGACTATTTGGATCAGATGAAAAAAATTGAAGAACATGAGGTGAATTTTGAATTTGAAATTAAAAAAGAAGAATTAGAATCTACAATAGATTTACCGGATTTTAAAATGGAATCTCAGGATTTTGATGAAGAATTAAATTCAGAGCGGAGCATCAATAGAGATTCCAGAAAACAGGAACCGATTTATGAAAATATTGCCGATAAATTTTTTAAATGTGAAATTTGTTCCAAGTATTTCACACAATCCGGTAATTTAAAAAGGCATATTAGAACTCACACTAACGAGAAACCTTTTAAATGTAAATTTTGTTTCAAATGTTTCACAATATCCAATAACTTAAAAAGACATATTAGAACTCACACAGGCGAGAAACCTTTTAAATGTAAATTATGTTCAAAATATTTCACACAATTAAGTCATTTAAATAGTCATATTAGAACTCACACTGGAGAAAAACCTTTTAAATGTGAAAATTGTTCGAAATGTTTCAAACAATTGAGTTATTTAAAATATCATATTAAAACTCACACTAACGAAAAACCTTTTAAATGTAAGATTTGTTCAAAATGTTTCACAACATCCAGTAATTTAAAAAGACACATTAGAACTCACATTGACAAAAACGCAAACTAA
Protein Sequence
MKTCAIKEEKIEIIDESKPEFDYLDQMKKIEEHEVNFEFEIKKEELESTIDLPDFKMESQDFDEELNSERSINRDSRKQEPIYENIADKFFKCEICSKYFTQSGNLKRHIRTHTNEKPFKCKFCFKCFTISNNLKRHIRTHTGEKPFKCKLCSKYFTQLSHLNSHIRTHTGEKPFKCENCSKCFKQLSYLKYHIKTHTNEKPFKCKICSKCFTTSSNLKRHIRTHIDKNAN

Similar Transcription Factors

Sequence clustering based on sequence similarity using MMseqs2