Agen059110.1
Basic Information
- Insect
- Agriphila geniculea
- Gene Symbol
- -
- Assembly
- GCA_943789515.1
- Location
- CALSUL010001456.1:218653-218979[-]
Transcription Factor Domain
- TF Family
- HTH
- Domain
- HTH_psq domain
- PFAM
- PF05225
- TF Group
- Helix-turn-helix
- Description
- This DNA-binding motif is found in four copies in the pipsqueak protein of Drosophila melanogaster [1]. In pipsqueak this domain binds to GAGA sequence [1].
- Hmmscan Out
-
# of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc 1 4 0.23 2.1e+02 3.5 0.0 24 34 15 25 14 27 0.88 2 4 0.039 35 6.0 0.0 24 36 36 48 36 54 0.87 3 4 0.039 35 6.0 0.0 24 36 58 70 58 76 0.87 4 4 0.039 35 6.0 0.0 24 36 80 92 80 98 0.87
Sequence Information
- Coding Sequence
- ATGATACGACGCGCCGCATCAGGCAATACAACGTGTCGCATCAGGCGATACGACGTGTCGTATCAGACGATACGTGTCGCATCAGACGATACGACGTGTCGCATCAGACGATACGACGTGTCGCATCAGACGATACGACGTGTCGCATCAGACGATACGACGTGTCGCATCAGACGATACGACGTGTCGCATCAGACGATACGACGTGTCGCATCAGACGACACGACGTGTCGCATCAGACGATACGACGTGTCGCATCAGACGATACGACGTGTCGCATCAGACGATACGACGTGTCGCATCAGACGATACGACGTGTCGCACTAG
- Protein Sequence
- MIRRAASGNTTCRIRRYDVSYQTIRVASDDTTCRIRRYDVSHQTIRRVASDDTTCRIRRYDVSHQTIRRVASDDTTCRIRRYDVSHQTIRRVASDDTTCRIRRYDVSH
Similar Transcription Factors
Sequence clustering based on sequence similarity using MMseqs2
- 100% Identity
- iTF_00034663;
- 90% Identity
- iTF_00034663;
- 80% Identity
- -