Basic Information

Transcription Factor Domain

TF Family: zf-GAGA
Domain: zf-GAGA domain
PFAM: PF09237
TF Group: Zinc-Coordinating Group
Description: Members of this family bind to a 5'-GAGAG-3' DNA consensus binding site, and contain a Cys2-His2 zinc finger core as well as an N-terminal extension containing two highly basic regions. The zinc finger core binds in the DNA major groove and recognises the first three GAG bases of the consensus in a manner similar to that seen in other classical zinc finger-DNA complexes. The second basic region forms a helix that interacts in the major groove recognising the last G of the consensus, while the first basic region wraps around the DNA in the minor groove and recognises the A in the fourth position of the consensus sequence [1].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 5 0.31 1.6e+02 2.4 0.0 21 43 52 74 49 77 0.81

2 5 0.16 82 3.4 0.1 21 43 80 102 72 107 0.80

3 5 0.12 59 3.8 0.0 18 44 105 131 100 135 0.81

4 5 6.7e-05 0.034 14.2 0.1 21 45 136 160 131 168 0.86

5 5 0.22 1.1e+02 2.9 0.0 17 43 187 214 181 218 0.76

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	5	0.31	1.6e+02	2.4	0.0	21	43	52	74	49	77	0.81
2	5	0.16	82	3.4	0.1	21	43	80	102	72	107	0.80
3	5	0.12	59	3.8	0.0	18	44	105	131	100	135	0.81
4	5	6.7e-05	0.034	14.2	0.1	21	45	136	160	131	168	0.86
5	5	0.22	1.1e+02	2.9	0.0	17	43	187	214	181	218	0.76

Coding Sequence: ATGAAGAACCTTTCTGATGATGCTGCGCCCGTGTGCAACCCAATACTTCTGCCACACCAGAGACATAGTGACATTGAGACCAGCATGCTGGTGGAGAAGGTGGATGGAGCGTATTACCATAGTTGTATACAGATGTGCCTTTGGACACACACCGGAGAAAAGCCATACATATGCGATATCTGTGGTCAAGCGTTTTCTCGTTCATCAACTTTAACAGAGCATACATGGACACACACCGGAGAAAAACCATTCAAATGTGGTATCTGTGATCAAGCGTTTTCTCGTTCATCAACTTTAACAGCGCATACAAGGAGACACACCGGAGAAAAACCATTCAAATGTGATATCTGTGATCAAACGTTTACTCAATTATCAACTTTAACATTTCACATAAGGACACACACCGGAGAAAAGCCATACATATGCGATATCTGTGGTAAAGCATTTTCTCAATCACAAAATTTAACAAGGCATACAAGGACACACACCGGAGAAAAACCATTCAAATGTGGTACCTGTGGTCGAGCGTTTTCTCTCTTACAATCTTTAAAAACACACGAAAGGTCACACACAGGAGAAACACCATTCAAGTGTGTTATCTGTGGTCAAGCGTTTTCTTATTTACAATCTTTAAACAGACACAAAAAGACACACACCGGATAA
Protein Sequence: MKNLSDDAAPVCNPILLPHQRHSDIETSMLVEKVDGAYYHSCIQMCLWTHTGEKPYICDICGQAFSRSSTLTEHTWTHTGEKPFKCGICDQAFSRSSTLTAHTRRHTGEKPFKCDICDQTFTQLSTLTFHIRTHTGEKPYICDICGKAFSQSQNLTRHTRTHTGEKPFKCGTCGRAFSLLQSLKTHERSHTGETPFKCVICGQAFSYLQSLNRHKKTHTG

Sequence clustering based on sequence similarity using MMseqs2