Basic Information

Transcription Factor Domain

TF Family: Runt
Domain: Runt domain
PFAM: PF00853
TF Group: Beta-Scaffold Factors
Description: The AML1 gene is rearranged by the t(8;21) translocation in acute myeloid leukemia [1]. The gene is highly similar to the Drosophila melanogaster segmentation gene runt and to the mouse transcription factor PEBP2 alpha subunit gene [1]. The region of shared similarity, known as the Runt domain, is responsible for DNA-binding and protein-protein interaction.In addition to the highly-conserved Runt domain, the AML-1 gene product carries a putative ATP-binding site (GRSGRGKS), and has a C-terminal region rich in proline and serine residues. The protein (known as acute myeloid leukemia 1 protein, oncogene AML-1, core-binding factor (CBF), alpha-B subunit, etc.) binds to the core site, 5'-pygpyggt-3', of a number of enhancers and promoters.
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 2 6.2e-48 2.7e-44 150.1 0.0 6 93 32 119 26 132 0.94

2 2 0.21 8.9e+02 -0.3 0.0 16 35 132 150 123 157 0.77

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	2	6.2e-48	2.7e-44	150.1	0.0	6	93	32	119	26	132	0.94
2	2	0.21	8.9e+02	-0.3	0.0	16	35	132	150	123	157	0.77

Coding Sequence: ATGCACCTTCCTTATGAGGGTAGAAGCCGACGCCGGCGAGAGATGGCCGAGGGTCACGACCCCTGGTGGATGCAGAACGTTATCGAAGAGACGCATGCTGAACACCCTGACTTAGTAACGACTGGCAGCCCCGACTTAATGTGTTCATCGCTACCACATCATTGGAGATCAAATAAGACTCTACCAGGAGGATTCAAGGTCGTGGCTTTAGGTGATATAGATGATGGTACATGGGTGACAATCAATGCGGGCAATGATGAAAACTTTTGCGCAGAATTAAAGAATAATAAAGCTATGATGAAAAATAGAGTCGCTAAGTTTAACGATTTGAGGTTCGTTGGGAGAAGTGGAAGGGGATACAGACCGTATTCCTATTCCACTCGTACCACTCTCCACAATCCGAACGCAACTCTCTCCTTCCTTCCTTCACATTTCTTCCACAAGTCTCTTCACACAGGCTCTATGGTTATGGGCGAATGGTGA
Protein Sequence: MHLPYEGRSRRRREMAEGHDPWWMQNVIEETHAEHPDLVTTGSPDLMCSSLPHHWRSNKTLPGGFKVVALGDIDDGTWVTINAGNDENFCAELKNNKAMMKNRVAKFNDLRFVGRSGRGYRPYSYSTRTTLHNPNATLSFLPSHFFHKSLHTGSMVMGEW

Sequence clustering based on sequence similarity using MMseqs2