Basic Information

Insect: Thumatha senex
Gene Symbol: -
Assembly: GCA_948477245.1
Location: OX419725.1:29591161-29591973[-]

Transcription Factor Domain

TF Family: zf-C2H2
Domain: zf-C2H2 domain
PFAM: PF00096
TF Group: Zinc-Coordinating Group
Description: The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [1].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 7 0.0013 0.13 13.7 5.4 1 19 62 80 62 85 0.92

2 7 0.0002 0.021 16.2 1.5 2 23 93 115 93 115 0.97

3 7 0.0031 0.31 12.5 0.2 1 19 119 137 119 140 0.95

4 7 5.9e-05 0.0059 18.0 0.4 2 23 147 169 146 169 0.94

5 7 0.00071 0.072 14.5 0.7 3 23 177 198 177 198 0.98

6 7 0.0014 0.14 13.6 0.5 3 23 205 226 203 226 0.94

7 7 0.00054 0.054 14.9 4.1 2 23 232 254 232 254 0.96

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	7	0.0013	0.13	13.7	5.4	1	19	62	80	62	85	0.92
2	7	0.0002	0.021	16.2	1.5	2	23	93	115	93	115	0.97
3	7	0.0031	0.31	12.5	0.2	1	19	119	137	119	140	0.95
4	7	5.9e-05	0.0059	18.0	0.4	2	23	147	169	146	169	0.94
5	7	0.00071	0.072	14.5	0.7	3	23	177	198	177	198	0.98
6	7	0.0014	0.14	13.6	0.5	3	23	205	226	203	226	0.94
7	7	0.00054	0.054	14.9	4.1	2	23	232	254	232	254	0.96

Sequence Information

Coding Sequence: ATGAATAATTTTGTGAAACCAGAAATTCAAGTAGATGTAGAGCGTCTGGATCCTGACACTACAGATCAGCGTTTAAATTCGGAGATTATAGACGAACATTTGAGGAATTCAACTGTGGTTTTAAGTGATATTTTAAAGTGTTCTGAAGTCATAGAATACTCACCTACAGAATCGAAGGAAGGCCATATGTGCCAGCATTGTGGAAAAATCTATAAAACTAATAGTACACTGCACGCTCATTGCCTTTTAATACATCCTCAAAATGCAGTAGAAGGACAATGCAAATCGTGTGACAAGAAGTATCCATCGTTGCTGAGCTTGCAAAAGCATATACGTTACAAGCACCGTTACGAGCATAGGTGTAAGGCGTGTTATAAAACATTTGCAACAGCTGATCTCCTATTTATCCATGGCGAGGGTTGCGGCAAAAGTGAGACACCTTGTTCTCAATGCGGAAAGGTGTTTGATTCGCCTCTTGCATTAAGGAACCACAAAAAATATAAACATCCAGAAAAACGAAACCACTGGTGCGAGTTGTGTCGACGCACATTTACTACGGAACGGAGGTTGATAAATCACATCGCAACGTTACACCCACCCGGTGCAACTGACTGCAGCTGGTGTGAAAGGAGTTTCAGCTCAGTAACTAGCATGCAAAGTCATATTCTGTACAAACATACAGTAGATGGAGCTAAATGTTTCAAATGTCATAAAGTATTTGCAAAAAAAGTTCGCCTACAAAGACATTTAGCTAAAAATCATTTCTTAAATATAACACTAAAGGACGATGACGACCAAAATAGTAATTCGTAA
Protein Sequence: MNNFVKPEIQVDVERLDPDTTDQRLNSEIIDEHLRNSTVVLSDILKCSEVIEYSPTESKEGHMCQHCGKIYKTNSTLHAHCLLIHPQNAVEGQCKSCDKKYPSLLSLQKHIRYKHRYEHRCKACYKTFATADLLFIHGEGCGKSETPCSQCGKVFDSPLALRNHKKYKHPEKRNHWCELCRRTFTTERRLINHIATLHPPGATDCSWCERSFSSVTSMQSHILYKHTVDGAKCFKCHKVFAKKVRLQRHLAKNHFLNITLKDDDDQNSNS

Similar Transcription Factors

Sequence clustering based on sequence similarity using MMseqs2

100% Identity: iTF_00441947;
90% Identity: -
80% Identity: -