Basic Information

Transcription Factor Domain

TF Family: zf-C2H2
Domain: zf-C2H2 domain
PFAM: PF00096
TF Group: Zinc-Coordinating Group
Description: The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [1].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 5 3.4e-06 0.0002 21.9 0.3 2 23 106 130 105 130 0.95

2 5 5.7e-06 0.00034 21.2 1.4 1 23 136 158 136 158 0.98

3 5 5.2e-06 0.00031 21.3 0.6 2 23 164 185 163 185 0.97

4 5 2.7e-06 0.00016 22.2 0.2 1 23 191 214 191 214 0.95

5 5 7.8 4.6e+02 1.9 0.1 2 8 220 226 219 227 0.83

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	5	3.4e-06	0.0002	21.9	0.3	2	23	106	130	105	130	0.95
2	5	5.7e-06	0.00034	21.2	1.4	1	23	136	158	136	158	0.98
3	5	5.2e-06	0.00031	21.3	0.6	2	23	164	185	163	185	0.97
4	5	2.7e-06	0.00016	22.2	0.2	1	23	191	214	191	214	0.95
5	5	7.8	4.6e+02	1.9	0.1	2	8	220	226	219	227	0.83

Coding Sequence: ATGGACAGTAACGATTTGTCATTTGTAAATGTACGAAAAATAGAATTAAGCGAAGTTGACTTCATAAAGAACACTACTGCTACTGAGCAGGACCCTCTAGCAGGTGTCAGCAAAGAAGTATCACAACCCTTTTACTACAAAGTGGACGATAAAGTATTTTCTGAACCACTTAAGATTGTCAATGAAGAGCTTCTAGAACAAGTTAAAAATGATAAAAAACAAGAAGAATTCTTATTTGTAGACAAAGTGACTGTCAAAAAGGAGCAAGGTAAAAGAAATAAATATATAGTTGATGTCGACTATTTAACTAGCCTGACATGTCCGCAGTCAAATTGCGGAAGGAAGTTTTCCTCGTCCGCCCTCCTGAAAGCTCACGTCCGCAAAGTGCACTGTTCTGAACCGAGTCACACGTGCGAGATATGCGGGAGAATGTTCAAAGCGAGATATCTTCTGTCTAGACACGCCATGACTCACGGGAATGCCACAATACAGTGTCCAATATGTAAGAAGGAGCTCTCCATGAGGACCAACCTGTCGACGCATATGCGCATGCACACGAACATTCGTTCGTACGCATGCGCAGTGTGCGGAAAGCGGTTCGCACGCGCATCCACTCTGTCGACGCACGTTCGGTTCCTCCATAGGGACGGCGATATTGTTTGCAACATATGCGGACTAAGGTAA
Protein Sequence: MDSNDLSFVNVRKIELSEVDFIKNTTATEQDPLAGVSKEVSQPFYYKVDDKVFSEPLKIVNEELLEQVKNDKKQEEFLFVDKVTVKKEQGKRNKYIVDVDYLTSLTCPQSNCGRKFSSSALLKAHVRKVHCSEPSHTCEICGRMFKARYLLSRHAMTHGNATIQCPICKKELSMRTNLSTHMRMHTNIRSYACAVCGKRFARASTLSTHVRFLHRDGDIVCNICGLR

Sequence clustering based on sequence similarity using MMseqs2