Basic Information

Insect: Sympetrum striolatum
Gene Symbol: tp53
Assembly: GCA_947579665.1
Location: OX388344.1:77516217-77523023[+]

Transcription Factor Domain

TF Family: P53
Domain: P53 domain
PFAM: PF00870
TF Group: Beta-Scaffold Factors
Description: P53 is a tumor suppressor gene product; mutations in p53 or lack of expression are found associated with a large fraction of all human cancers. P53 is activated by DNA damage and acts as a regulator of gene expression that ultimatively blocks progression through the cell cycle. P53 binds to DNA as a tetrameric transcription factor. In its inactive form, p53 is bound to the ring finger protein Mdm2, which promotes its ubiquitinylation and subsequent proteosomal degradation. Phosphorylation of p53 disrupts the Mdm2-p53 complex, while the stable and active p53 binds to regulatory regions of its target genes, such as the cyclin-kinase inhibitor p21, which complexes and inactivates cdk2 and other cyclin complexes [PMID: 20066118, PMID: 12629332, PMID: 1397838, PMID: 6544917, PMID: 19826090, PMID: 19776744, PMID: 6278740, PMID: 221923, PMID: 6318442, PMID: 20030809].This domain is found in p53 transcription factors, where it is responsible for DNA-binding. The DNA-binding domain acts to clamp, or in the case of TonEBP, encircle the DNA target in order to stabilise the protein-DNA complex [PMID: 11780147]. Protein interactions may also serve to stabilise the protein-DNA complex, for example in the STAT-1 dimer the SH2 (Src homology 2) domain in each monomer is coupled to the DNA-binding domain to increase stability [PMID: 9630226]. The DNA-binding domain consists of a beta-sandwich formed of 9 strands in 2 sheets with a Greek-key topology. This structure is found in many transcription factors, often within the DNA-binding domain.
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 2 1.1e-62 1.3e-57 197.5 1.2 2 192 74 260 73 261 0.96

2 2 0.063 7.6e+03 -0.7 0.0 19 43 278 302 270 329 0.77

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	2	1.1e-62	1.3e-57	197.5	1.2	2	192	74	260	73	261	0.96
2	2	0.063	7.6e+03	-0.7	0.0	19	43	278	302	270	329	0.77

Sequence Information

Coding Sequence: ATGATTGATATTCTTTTATCCTTTTCTAAAGTTTGTCGGAAAACCGACACAATGGTTACCAAAGGAGAAGAATTCCTGTGTAGCCAGGAACCGTCACTTAGTGAAAGTGATCTTCAAGCAGTGCTCGGCATGTACGATGTATTCGATATGGATCAGTTATCGGAAGAGGAGAAGTTTAAGGTGACATTGCCACCATCTCCGACTTGCCCCCTGCCGTCAACAGAGGATTGGTCTGGATCATATGATTTTGAACTCAAAGTCAATACTGTTAATGCGAACAAGAAAACATGGCTATTTTCGAGTTCATTGAATAAGATATTCATTGATGTGCACAAAAGCATTCCACTGCAGTTCAAGATTAACTGCCCTGATGATGGGGAAGCCTTCTCCATCAGAGCACTACCCGTTTATAGTATATCTCAGCACATGACTTTTCCCGTCAACCGATGCCCTTTACACCTGAAAGAAGACGAGAATAAAGGAGTAACTAAACGGAATCATGTGGTTCAGTGTGAAGACCTCCGTGCCCTATATGAATATGACGAGGAAAGTAAGCGCTACAGTGTACTCACTACCTTAGGATGCCCACAGCCTGGCTCCGACTTGGTGACACGCATGTATTCATTTTCCTGCAAGAGCAGTTGCTGCGGGGGGATGAATCGCAGACCCATAATGGTCATTTTCACTCTAGAGAGAGACCAGCATGTGGTTGGGAGAAAAACATTGAACTTCAGAGTCTGCAGTTGTCCTAAAAGAGACAAGGATAAAGAAGAGAAGGCTGCAATGGAAGAAAAACTACGAGAAGAACCTCAGAACCATCCTGGAAAGATTAAGAAGGAAAAGGAGAGCAGCATGAATCCCTCTAAAAAAAGGAAGTCCTTGTTTGCTTCAAATGAAGAAAATGCTTCCTCTAGCAAGATCCATGGTACTGCTCATTATCGTGAAATACTGCGGCATCTAATTATGCTGAAGTGTGCTGAGTTTGATGAAACAGGATCACAAGAAGCCTTAGCTAGCAAAGCAGAATACGAAGATTTGTGGTAA
Protein Sequence: MIDILLSFSKVCRKTDTMVTKGEEFLCSQEPSLSESDLQAVLGMYDVFDMDQLSEEEKFKVTLPPSPTCPLPSTEDWSGSYDFELKVNTVNANKKTWLFSSSLNKIFIDVHKSIPLQFKINCPDDGEAFSIRALPVYSISQHMTFPVNRCPLHLKEDENKGVTKRNHVVQCEDLRALYEYDEESKRYSVLTTLGCPQPGSDLVTRMYSFSCKSSCCGGMNRRPIMVIFTLERDQHVVGRKTLNFRVCSCPKRDKDKEEKAAMEEKLREEPQNHPGKIKKEKESSMNPSKKRKSLFASNEENASSSKIHGTAHYREILRHLIMLKCAEFDETGSQEALASKAEYEDLW

Similar Transcription Factors

Sequence clustering based on sequence similarity using MMseqs2

100% Identity: -
90% Identity: -
80% Identity: -