Sric006543.1
Basic Information
- Insect
- Samia ricini
- Gene Symbol
- -
- Assembly
- None
- Location
- BLXV01000026:1190570-1212421[+]
Transcription Factor Domain
- TF Family
- zf-C2H2
- Domain
- zf-C2H2 domain
- PFAM
- PF00096
- TF Group
- Zinc-Coordinating Group
- Description
- The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [1].
- Hmmscan Out
-
# of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc 1 11 0.089 5.8 7.8 0.2 1 23 191 213 191 213 0.95 2 11 0.0017 0.11 13.2 0.1 1 23 246 269 246 269 0.96 3 11 4e-05 0.0026 18.3 3.3 2 23 275 297 274 297 0.94 4 11 0.0016 0.11 13.2 2.7 2 23 304 325 303 325 0.97 5 11 2.4e-05 0.0016 19.0 1.1 3 23 343 363 341 363 0.96 6 11 0.01 0.68 10.7 0.1 2 23 368 390 367 390 0.95 7 11 0.063 4.1 8.2 1.6 2 23 402 424 402 424 0.96 8 11 0.0012 0.079 13.6 1.5 1 23 431 454 431 454 0.93 9 11 0.0089 0.58 10.9 2.1 5 23 466 485 463 485 0.95 10 11 0.00073 0.048 14.3 3.3 1 23 494 516 494 516 0.97 11 11 0.0015 0.1 13.3 0.4 1 23 521 544 521 544 0.95
Sequence Information
- Coding Sequence
- atggatctgtcaatcaagaaaagagaaatctcgcctactgataatgcacctgtgtataatgaaagcttggatggtacaaacatgttaacaaaattaaaaaatattgatcatgaaataaaggtatggattaaggaggaaccaatagatccagaggagaataatgaatctgatacgggagaagtcaactcactcattaaacaggaacctccagacccagatgaaagtcaagaaccatctgaagatgcactgatttatcctgtacacgttgaaagtgttaaggttgaaccaatactttttgaatatggagatgataatgcattacaagataaagaatcgtcggaagaagaagattctgaagaggaatatattccggaaacggaagcgaataatgctaagaaaaaggcaaaaaacgataagaatgataagtcatcagcaaaagatgcatcagaaaaggacgtcaatctagaatattctgaggacgttatgaaactggtcaccgtgtacacgcttacggaagaggagcgactacaggagtacaggaatgctttggagtcgaggaaacacatggacttcttgtgcaagttttgcgctctcggcttcgtcttgcagaatgcttatgaggagcatatgaagattcatcagtctagcttcggtgtttacgagtgcaagttgtgccacgcttggcacaagacgaccctgtcgttgaagcagcacagtctgcggcattaccgccgctatcggtgctccgtctgcggggctcgttaccgtgataaggactcggcagctagtcacgcgatgcgagcccacgccgggcacgtgctccgctgtaagcactgcaacaggggcttcaaacgtccgcgatacctgaagcagcatatcgaacaataccacaatcgtacagaaagtatcgagtgtacgatttgtaaacgagtcttctatgacaagtatatgatccgctgccatatgaggacacataataaggaagtgcgagcgaggaaacagcagcagaggaaggtggtcatcaactgtccgatttgttcgaggcagtataggaacaaaacgagtctgaagaaacatctcctgagtcacgagcagaacgtaccgtgtgacctctgcgacgagatctcagcggacagggcggcgctcaggaagcactaccaccgggcacacaaccggctcttcatcagtactcctaaggaggagacatgtccgtactgcttcaggctgtgcgccaccgggcagatgctgaaacggcacatcgagcggatgcacaccgaccggaccaggaagtaccagtgcgaccactgccagcggctgttcatgactaagagcgaagtgaagtcgcacatcgtgtggacgcacttgccggcgagtatccgcggcgggcacgtgtgccactgcgggaagctgttccggtcaccgtcgctgctggcggaccacgttaaccgccggcacaggggccacaacccgcccagggaccaccggtgcccctgctgcgggaaaggatttatggataaacaagtcctgaatcgtcatatgaaagtgcattccgaagaaatgtacccgtgcaaggagtgcggcctcgagttcaaaacgaaaccgtacgtcgatgtgcattacaagctgaagcatctgaacatgacgcgcgccgagatcaaagcagagaagagaatgaacggaaagagaataagggagaacagcaggatccagtccagcgggaacatgatcgttgacagcgagtgctccaagcccggacgagctgccaccaaaccggctttggactccgatgagaccggagacacttcgagctatgcatcgattggaatcgaacccgtgatcataaagcattgtgatatcaaactagaaccagccgatgatgacttgccatccgtagatgatccatcggatgtccattga
- Protein Sequence
- MDLSIKKREISPTDNAPVYNESLDGTNMLTKLKNIDHEIKVWIKEEPIDPEENNESDTGEVNSLIKQEPPDPDESQEPSEDALIYPVHVESVKVEPILFEYGDDNALQDKESSEEEDSEEEYIPETEANNAKKKAKNDKNDKSSAKDASEKDVNLEYSEDVMKLVTVYTLTEEERLQEYRNALESRKHMDFLCKFCALGFVLQNAYEEHMKIHQSSFGVYECKLCHAWHKTTLSLKQHSLRHYRRYRCSVCGARYRDKDSAASHAMRAHAGHVLRCKHCNRGFKRPRYLKQHIEQYHNRTESIECTICKRVFYDKYMIRCHMRTHNKEVRARKQQQRKVVINCPICSRQYRNKTSLKKHLLSHEQNVPCDLCDEISADRAALRKHYHRAHNRLFISTPKEETCPYCFRLCATGQMLKRHIERMHTDRTRKYQCDHCQRLFMTKSEVKSHIVWTHLPASIRGGHVCHCGKLFRSPSLLADHVNRRHRGHNPPRDHRCPCCGKGFMDKQVLNRHMKVHSEEMYPCKECGLEFKTKPYVDVHYKLKHLNMTRAEIKAEKRMNGKRIRENSRIQSSGNMIVDSECSKPGRAATKPALDSDETGDTSSYASIGIEPVIIKHCDIKLEPADDDLPSVDDPSDVH
Similar Transcription Factors
Sequence clustering based on sequence similarity using MMseqs2
- 100% Identity
- -
- 90% Identity
- -
- 80% Identity
- -