Basic Information

Insect: Samia ricini
Gene Symbol: -
Assembly: None
Location: BLXV01000007:19920768-19932889[-]

Transcription Factor Domain

TF Family: zf-C2H2
Domain: zf-C2H2 domain
PFAM: PF00096
TF Group: Zinc-Coordinating Group
Description: The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [1].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 11 4.7e-05 0.0031 18.1 0.6 1 23 275 297 275 297 0.97

2 11 0.00094 0.062 14.0 0.8 2 23 305 326 305 326 0.97

3 11 0.0024 0.15 12.7 1.2 1 23 330 352 330 352 0.97

4 11 0.065 4.3 8.2 0.9 1 23 357 380 357 380 0.98

5 11 0.019 1.2 9.9 2.2 1 23 387 410 387 410 0.96

6 11 1.5 95 3.9 0.2 1 23 422 446 422 446 0.91

7 11 4.4e-05 0.0029 18.1 0.2 2 23 465 487 465 487 0.97

8 11 0.00066 0.043 14.5 1.1 2 23 543 564 542 564 0.96

9 11 0.023 1.5 9.6 0.1 2 23 570 591 569 591 0.96

10 11 2e-05 0.0013 19.3 1.5 1 23 597 619 597 619 0.97

11 11 2.2e-05 0.0015 19.1 2.1 1 23 625 648 625 649 0.97

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	11	4.7e-05	0.0031	18.1	0.6	1	23	275	297	275	297	0.97
2	11	0.00094	0.062	14.0	0.8	2	23	305	326	305	326	0.97
3	11	0.0024	0.15	12.7	1.2	1	23	330	352	330	352	0.97
4	11	0.065	4.3	8.2	0.9	1	23	357	380	357	380	0.98
5	11	0.019	1.2	9.9	2.2	1	23	387	410	387	410	0.96
6	11	1.5	95	3.9	0.2	1	23	422	446	422	446	0.91
7	11	4.4e-05	0.0029	18.1	0.2	2	23	465	487	465	487	0.97
8	11	0.00066	0.043	14.5	1.1	2	23	543	564	542	564	0.96
9	11	0.023	1.5	9.6	0.1	2	23	570	591	569	591	0.96
10	11	2e-05	0.0013	19.3	1.5	1	23	597	619	597	619	0.97
11	11	2.2e-05	0.0015	19.1	2.1	1	23	625	648	625	649	0.97

Sequence Information

Coding Sequence: atgtacagtctccaagaaggagtgttaaagtcatgtattgaagtcattcatggattgattgaaaatattaatatagaagggatgccacagtttgtttgctatgaatgtagggcttgtttaataaagttttatcagcttttagagaagagcatgatagcacaagcaacacttttagatatatttgcaattcatggaaagttatcaatgaacttgattaaaaaacaagatcgaacaaaacttaacttaaattcatcattaagttgctataaaccgagtcgtacctataaatacatgtacgacgatggtgatgataaatatttaacaattaaaagagttgattatattgataataatgatgatgaatatttcaaatgtgatgataacaaaagtcaaatagaaaataaattcacaagtgaaccatgggatgacactataaaaagtgatgttatcaatcaaacagaaaatatacaggaagaaataacatgtgacaatacttattatataaatagtgatgatccaacagacactaaagaaagtgttactattgcaaatgagatagagtatatttctggagacaatgaagtcttagatgatttcgaatcttatgttgttatagaagtgaagaatgaaaaacaaattagcagtcataatgaattggacaagaaatcaaatatgaagaagaaatctaaaagtaacaatagattaacacatattgaggttaatatgaaagaacactttgatgtcgtgaagttatcgttacaggaacaaatcgaagagtggaagaaagcgagagaaactacaacaataaccagcgaaacagtgtacaagtgtgagatttgttcgaaaatatttgctcacgtgtcgtcatatcaaaaccatatcgccggtcacgaccctagtcgtggtaaagaggaatgtccagtttgtaaattacgcttcaagagcaagttacaagtacaattgcacagacgggtgcataggaataaattctattgcaaattatgccctaaagttttcaatacgatgactgtcgctaggaaacactaccggtggcacacgggtcaccggtacaagtgcagctggtgcacgttcacgagcgcgcatgagtccgccgtgggtacacacgtgcgtacgtcacacgcgcgcttgcccggcgcgtacacgtgcacgcgctgcggcctcacctgctgctctgaacgcggactggcgctgcaccgctccatcgctcataagcaccaaccggaattagaaataaccgggaagtataaatgtgaaccttgcgacttgtacttcgcgtcagaaggcgctaggcgtctgcatttacttacaactagacacgacaggacaattaccagcgattcaacatcccctggggattctggtctgataaatacatgcgataaatgcaacaaggggtttccgtctctagtcgatctgaaacaacacatcgaaactgagcaccagaatggcgtagagacgaacacaaccgggagggaacgagataaatctcgtccgactttatgtgaacactgcggtgaatcaatgaagagtaggaaagagcattacttgcacatcatcaggcaacatcccaaagagaaacatttataccaaccggtgatcagaacggtctgtgagatttgcgggaaagggtttcagaactcgactaaattgcacctacacgagttacgacacagtcagccgacagttaagtgtgattactgtccgcggctgttctatgacaagtacgcggccgcgatacacaggacggtacacgagaccgctaaaccgtacgcgtgtcgcacttgcggacgcactttcaagttgaagggaaacctctacagacactcgagggttcattctagtgtcgctgcgtatgaatgtcctatgtgcgagaaaaagttcaaatattcgtacagcgtgaacctgcacgtgcggaccgtgcatcacaagatgccgtatccttcgcggaagaaaagaaagctcaatagaactgtcattaatagtcccgataatacaactactatttaa
Protein Sequence: MYSLQEGVLKSCIEVIHGLIENINIEGMPQFVCYECRACLIKFYQLLEKSMIAQATLLDIFAIHGKLSMNLIKKQDRTKLNLNSSLSCYKPSRTYKYMYDDGDDKYLTIKRVDYIDNNDDEYFKCDDNKSQIENKFTSEPWDDTIKSDVINQTENIQEEITCDNTYYINSDDPTDTKESVTIANEIEYISGDNEVLDDFESYVVIEVKNEKQISSHNELDKKSNMKKKSKSNNRLTHIEVNMKEHFDVVKLSLQEQIEEWKKARETTTITSETVYKCEICSKIFAHVSSYQNHIAGHDPSRGKEECPVCKLRFKSKLQVQLHRRVHRNKFYCKLCPKVFNTMTVARKHYRWHTGHRYKCSWCTFTSAHESAVGTHVRTSHARLPGAYTCTRCGLTCCSERGLALHRSIAHKHQPELEITGKYKCEPCDLYFASEGARRLHLLTTRHDRTITSDSTSPGDSGLINTCDKCNKGFPSLVDLKQHIETEHQNGVETNTTGRERDKSRPTLCEHCGESMKSRKEHYLHIIRQHPKEKHLYQPVIRTVCEICGKGFQNSTKLHLHELRHSQPTVKCDYCPRLFYDKYAAAIHRTVHETAKPYACRTCGRTFKLKGNLYRHSRVHSSVAAYECPMCEKKFKYSYSVNLHVRTVHHKMPYPSRKKRKLNRTVINSPDNTTTI

Similar Transcription Factors

Sequence clustering based on sequence similarity using MMseqs2

100% Identity: -
90% Identity: -
80% Identity: -