Sric017437.1
Basic Information
- Insect
- Samia ricini
- Gene Symbol
- -
- Assembly
- None
- Location
- BLXV01000022:1750696-1759866[+]
Transcription Factor Domain
- TF Family
- zf-C2H2
- Domain
- zf-C2H2 domain
- PFAM
- PF00096
- TF Group
- Zinc-Coordinating Group
- Description
- The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [1].
- Hmmscan Out
-
# of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc 1 14 0.43 28 5.6 4.1 1 20 180 199 180 200 0.90 2 14 0.00072 0.047 14.3 4.3 2 23 209 231 209 231 0.97 3 14 0.00024 0.016 15.8 2.5 3 21 246 264 245 265 0.95 4 14 7.3e-05 0.0048 17.5 2.4 1 23 274 297 274 297 0.98 5 14 1.9 1.2e+02 3.6 1.9 5 23 307 326 305 326 0.90 6 14 0.00032 0.021 15.4 3.0 1 23 335 358 335 359 0.96 7 14 8.2e-07 5.4e-05 23.6 4.8 2 23 390 412 389 412 0.97 8 14 0.015 0.98 10.2 0.4 6 23 423 440 421 440 0.92 9 14 0.00073 0.048 14.3 1.9 2 23 448 470 447 470 0.95 10 14 0.0038 0.25 12.1 0.1 6 23 481 499 479 499 0.89 11 14 0.025 1.6 9.5 0.4 2 21 512 531 511 535 0.87 12 14 0.063 4.2 8.2 4.1 2 23 575 597 574 598 0.96 13 14 0.0019 0.12 13.0 0.7 6 23 609 627 607 627 0.93 14 14 0.0067 0.44 11.3 3.4 2 23 640 662 639 662 0.91
Sequence Information
- Coding Sequence
- atggatagggaatatttagtaccaattcctgaaactttgagtaccacaactccagagactcagtggaatcaacagatcgatacacccatgctgaaacaagaaatagaaaatggcatagatgaagaatatttagctgagagtgattacaatatgttatctcaacatgtcaattactatgacagtgaggttcatgtgttaggtgaaattaaggaagaactttatgggtatgatgatcctcaagcagattgtagtacagataaaatattttctgaaaataacagattagtaaatgttaaagataaacacaaagtagacaatgcaaacataaatggaccattagatataaagcaagaaaaaaaggataatatatatgagcttacaataaaattagaggcggatgaccagaaagaaattatagataatgctgaaaacactataccgttgtacagtaaaaatagttccaatttattacagcacaataatgaacatataaatattaaaataaacacttcagacaataatggaatgaaggagttacataagtgccaatattgtagtgaatgttttaataaacatgatcgtatgcttgcgcatgtcagttgctatcacagaatggaatgtcccaagtgtgagctatgtggaaaacatttcaagacggtgcaaaatgttaaacatcacattttaaaattacataaaatcaagttgccaattagagtaattcgaaagaataaaatatgtacaaattgtaatctcgttttcaagcacaaatcaactttcaaaagacatattaagttttgccgtcccgctaagaaaattacatataaatgtggttcatgtgtgaaatttttcaaaactagatattctttagtaattcacatgaaacggactcattataatttcgggagaatgtttaagtgttggtgcggggagcagttccatactccaatacacttgagcgagcacaaaagcttacagcatactggtaataggaatagagagaagtacaagtgtaaattttgtgatgcagtgtttaattcaaacaggtatttaacaattcatgaacaaaggagtcatcatgattctgggagaaatactgaagaacaaacagccaatcatgagacacggcgccatgatcggctaagtgagagtacatataaaggcaaagttcaatgtgatcattgccatagaactttcacaaacaattcatatttaatgaaacatattagaagaattcataacgattatggtaaagtgtttagatgttggtgcgggaaagagtaccgtactccgtaccacttaaaggggcatgagggtatgcataactatgaaaaaaccaaagtccagtgtgacacgtgtaagagattttacaaaaacagttattcattatatagacataaaataaaaatccacaatgattatggtaaagtatatgattgttggtgcgggaaagaattcagtactccggcacagttagaagtacataaggaccaagaacacaatagtccaattgaagaagtaaataattacaaagtccaatgtattaaatgcaagagttcctttacaaaccttaattctttacaaagacatataataggaactgatcatgattatgataatagggtattcttaagttggtgcgggaaagaaatccatactccgttaccagataataaggatcaacagcataatagtacaactgaagatataagcaatggtaaagtccaatgtgtaatctgcaacactactttaaaaaacagaacttctttaatgtgccacatgagaaggatccaccatgattatggtagcaaagtatttgcatgttggtgcgggaaagtgttccgtactccgtacaagttgtccagtcataagagtatgagccatgactgtaaatctgatagaactctcgctactagagtccaatgcgatgtttgccagaagttttataaaagcaatcgtttattagaaagacattgtaaaagaatgcattacgattatttgtttgagtga
- Protein Sequence
- MDREYLVPIPETLSTTTPETQWNQQIDTPMLKQEIENGIDEEYLAESDYNMLSQHVNYYDSEVHVLGEIKEELYGYDDPQADCSTDKIFSENNRLVNVKDKHKVDNANINGPLDIKQEKKDNIYELTIKLEADDQKEIIDNAENTIPLYSKNSSNLLQHNNEHINIKINTSDNNGMKELHKCQYCSECFNKHDRMLAHVSCYHRMECPKCELCGKHFKTVQNVKHHILKLHKIKLPIRVIRKNKICTNCNLVFKHKSTFKRHIKFCRPAKKITYKCGSCVKFFKTRYSLVIHMKRTHYNFGRMFKCWCGEQFHTPIHLSEHKSLQHTGNRNREKYKCKFCDAVFNSNRYLTIHEQRSHHDSGRNTEEQTANHETRRHDRLSESTYKGKVQCDHCHRTFTNNSYLMKHIRRIHNDYGKVFRCWCGKEYRTPYHLKGHEGMHNYEKTKVQCDTCKRFYKNSYSLYRHKIKIHNDYGKVYDCWCGKEFSTPAQLEVHKDQEHNSPIEEVNNYKVQCIKCKSSFTNLNSLQRHIIGTDHDYDNRVFLSWCGKEIHTPLPDNKDQQHNSTTEDISNGKVQCVICNTTLKNRTSLMCHMRRIHHDYGSKVFACWCGKVFRTPYKLSSHKSMSHDCKSDRTLATRVQCDVCQKFYKSNRLLERHCKRMHYDYLFE
Similar Transcription Factors
Sequence clustering based on sequence similarity using MMseqs2
- 100% Identity
- -
- 90% Identity
- -
- 80% Identity
- -