Sric019441.1


Basic Information
Transcription Factor Domain
Sequence Information
Similer Transcription Factors

Basic Information

Insect
Samia ricini
Gene Symbol
znf423
Assembly
None
Location
BLXV01000032:1130880-1179458[-]

Transcription Factor Domain

TF Family
zf-C2H2
Domain
zf-C2H2 domain
PFAM
PF00096
TF Group
Zinc-Coordinating Group
Description
The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [1].
Hmmscan Out
# of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc
1 10 5e-05 0.0033 18.0 2.5 1 23 151 174 151 174 0.93
2 10 1 67 4.4 0.0 2 23 200 222 199 222 0.90
3 10 0.027 1.8 9.4 1.4 1 23 244 266 244 266 0.99
4 10 3.3e-05 0.0022 18.5 0.2 1 23 270 292 270 292 0.98
5 10 0.0011 0.069 13.8 3.3 1 23 297 319 297 319 0.97
6 10 0.046 3 8.7 1.6 1 23 325 348 325 348 0.96
7 10 6.2e-06 0.00041 20.8 4.4 1 23 355 378 355 378 0.97
8 10 0.00012 0.0076 16.8 1.4 1 23 384 406 384 406 0.98
9 10 5.1e-05 0.0034 17.9 0.8 1 23 412 434 412 434 0.99
10 10 9.1e-06 0.00059 20.3 2.7 1 23 440 463 440 463 0.97

Sequence Information

Coding Sequence
ctggaatcaattgagaacagtgagggtggcatatctgcagttgttaaagtggaaacacaagaggaagacaatcaatctgatgacaatatttcaaatgacgatggtttctctggaacagagtttgaagtgccaattaaaactgaaagtgccgaagatgggaagtcgaaaaagcgtgctgctcccactaaagcgagcacttcgcgaaccaagaagtcgaaagctaacgaggaatctgccgataccagcacaactaaacgtaaacaattccatgtcgaaaaaggcaaagcaaaaacaaaagtaattattatagatcgaaaggacaataatactgatgcagaagataaacctaagctagtgacttataaaagaagcgataaacatcttattaatgttaaagagatattaaactgcaccaacgcgactccgatcggacgataccacgtcataggattctcctgttgttactgcaaggaaaagtttagacaaccggaagaattgaagaggcatacattagcaatacataaggatgttactggtgccagttttatgaataaatccctacgtgagttcaacgctaaacttgacataaccatgttaaaatgcaaactttgcgacatcagcatcgatacaatcgagcaagcgatcgaacatttaaaggaagctcacgcaaaaaatatgacaacggacatcgagaaccatataattccatttaaatttgatagtggtatatacaagtgctgcatatgtgcgacagagttcggtaaatataagccgcttctacttcatatgaacatgcattataggaactatgagtgttcgatatgcggagctggtttcattaatgcgcacatgctaaacagtcataaacagatccacgaatcgggtgagttcaattgtcaaatctgccacaaagtattcaacagtaatcagaagcgaaaggcacacgagaaaatccacacagacgggaattgccacaagtgtccatactgcatcgaacggtttagcagtaacaaatataaagacgtgcatatggcgaaggcgcacggcgtaccgctagcgacttacagctgcaaggcttgcgataaaacgtttacgaatagttcgcattacaatacgcacttaaagcgtgatcacttgatggagaaacgtcataaatgcgtgttgtgcactaaagcgtttttctcgccgcgtttattgagggaccacatgatttcgcattcgggggagaggaagtttcagtgcgaagtgtgccttaagtcctacggaatgaagaggaccctgagggagcatatgcggatacataacaacgatcgtagatttaaatgcgaggaatgcggtcaggccttcgtgcagaagtgtagctggaaatcgcatatgcggaataagcatggatatttgaaatgttcttaa
Protein Sequence
LESIENSEGGISAVVKVETQEEDNQSDDNISNDDGFSGTEFEVPIKTESAEDGKSKKRAAPTKASTSRTKKSKANEESADTSTTKRKQFHVEKGKAKTKVIIIDRKDNNTDAEDKPKLVTYKRSDKHLINVKEILNCTNATPIGRYHVIGFSCCYCKEKFRQPEELKRHTLAIHKDVTGASFMNKSLREFNAKLDITMLKCKLCDISIDTIEQAIEHLKEAHAKNMTTDIENHIIPFKFDSGIYKCCICATEFGKYKPLLLHMNMHYRNYECSICGAGFINAHMLNSHKQIHESGEFNCQICHKVFNSNQKRKAHEKIHTDGNCHKCPYCIERFSSNKYKDVHMAKAHGVPLATYSCKACDKTFTNSSHYNTHLKRDHLMEKRHKCVLCTKAFFSPRLLRDHMISHSGERKFQCEVCLKSYGMKRTLREHMRIHNNDRRFKCEECGQAFVQKCSWKSHMRNKHGYLKCS

Similar Transcription Factors

Sequence clustering based on sequence similarity using MMseqs2

100% Identity
-
90% Identity
-
80% Identity
-