Basic Information

Insect: Samia ricini
Gene Symbol: prg
Assembly: None
Location: BLXV01000001:27135214-27137003[-]

Transcription Factor Domain

TF Family: zf-C2H2
Domain: zf-C2H2 domain
PFAM: PF00096
TF Group: Zinc-Coordinating Group
Description: The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [1].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 10 0.045 2.9 8.7 3.0 1 23 174 197 174 197 0.94

2 10 0.46 30 5.5 0.2 1 23 203 226 203 226 0.94

3 10 8.6e-07 5.6e-05 23.5 1.8 1 23 232 254 232 254 0.96

4 10 1.2e-06 8e-05 23.1 3.0 1 23 260 282 260 282 0.99

5 10 1.7e-05 0.0011 19.5 0.1 1 23 288 310 288 310 0.97

6 10 0.00016 0.01 16.4 2.6 1 23 316 338 316 338 0.97

7 10 6.4e-05 0.0042 17.6 1.0 2 23 430 452 429 452 0.95

8 10 4.4e-05 0.0029 18.2 1.2 1 23 458 480 458 480 0.95

9 10 1.9e-05 0.0013 19.3 3.4 1 23 486 508 486 508 0.98

10 10 0.0014 0.089 13.5 0.0 3 23 517 537 515 537 0.92

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	10	0.045	2.9	8.7	3.0	1	23	174	197	174	197	0.94
2	10	0.46	30	5.5	0.2	1	23	203	226	203	226	0.94
3	10	8.6e-07	5.6e-05	23.5	1.8	1	23	232	254	232	254	0.96
4	10	1.2e-06	8e-05	23.1	3.0	1	23	260	282	260	282	0.99
5	10	1.7e-05	0.0011	19.5	0.1	1	23	288	310	288	310	0.97
6	10	0.00016	0.01	16.4	2.6	1	23	316	338	316	338	0.97
7	10	6.4e-05	0.0042	17.6	1.0	2	23	430	452	429	452	0.95
8	10	4.4e-05	0.0029	18.2	1.2	1	23	458	480	458	480	0.95
9	10	1.9e-05	0.0013	19.3	3.4	1	23	486	508	486	508	0.98
10	10	0.0014	0.089	13.5	0.0	3	23	517	537	515	537	0.92

Sequence Information

Coding Sequence: atggaagattcctatataatagcaaacttccacgccctgtgtcgtctttgcttgaacaagagctcgtttggtacctcaatattcggggcagcgcctgacgacgaaacaaatatatccataacctctaaaatagctgaatgtctggaactacgaattgaccctaatgacggcctaccaggaaggatttgttacaagtgcttattcaaagtagaaaaatgttcaaaatttaaacttcagtgtattcaaagtgagaacagactaaaacaaatcacaaaacaatataatgaaatagatgagacaaccccggaacctgctgaatacaattacaacaatgcagatctcctgaaatctaaaaatgaagagtttattgtagacagtgtagtcatggttgtagaccctagcctggactatgattcatcagaagaatctgacactgttgaaacagcagaacaagataatattgagagaagtaatactcctgaaaaagaaattagtcaagattcgttttttaaaaatgtttttatgtgtcaatattgtgatcaagcatttatttcacaagagaaatgtaaagaacatgagaagatgttccataatccaaacttaccatataaatgtattgagtgcagtgttgtgtttgctgaaagaactcaatatgtgcaacatgcaaaacaaatacatggaaatgataaaccttataactgtcctgaatgtgataaatgctttggtagacggtcagatttgagaaagcattctattgttcatacaggtattagaccttatcagtgtcaattttgtttaaagagtttctctcgtaacacaaacttgagtaaacatctgcgaatacatgcaggacacaagcctcatgtttgtcctctttgtccaagaagttttgttgcaaaagcagatctacaaagacatgtgctagttcattctggtattaaaccatactcctgccacagatgccctgctacatttaggagaagggataaattgttaaaacatgaagctcgtcatgaagcaattggttctgaaaaatgtcattcatttgataaaactgaagaaactcatgatatggttgtaagtataaatcctttcagtaatattatgacttctcccatagatatgcatacagagtctgcaactactaattatgatttacctagaataccagatcatatatcaggagagagtagttttacaaaaatccaaaagagttctggtgctacaaataaacaagttccaatatctccaccaaagaaagttaataaaaatcggcccaaaaatattaaatgccaccaatgtcctaaaagattttcttctttagatgcttacaaaactcatgtgtccattgcccatatggggtccagagttttccaatgcaagatatgttttaaaaagtttgctcgtaaaagagaacttgatcgtcatgcagctcttcatacaggcatgaagcctttctcttgtaatcaatgtgataaaaaatttactaagaaggacaaacttgataaacacgaacagacccatgagtgtttggttatgaatatgccttgtattgaatgtggagcgacatttgagaaaaaagctgacctagttgctcacataaaatcacattttactgataatttacatgaaaagttatctgagactgaaattaaaaaagaggaagaaccagaatatacagtagatgacaatttctataatttagaaacataa
Protein Sequence: MEDSYIIANFHALCRLCLNKSSFGTSIFGAAPDDETNISITSKIAECLELRIDPNDGLPGRICYKCLFKVEKCSKFKLQCIQSENRLKQITKQYNEIDETTPEPAEYNYNNADLLKSKNEEFIVDSVVMVVDPSLDYDSSEESDTVETAEQDNIERSNTPEKEISQDSFFKNVFMCQYCDQAFISQEKCKEHEKMFHNPNLPYKCIECSVVFAERTQYVQHAKQIHGNDKPYNCPECDKCFGRRSDLRKHSIVHTGIRPYQCQFCLKSFSRNTNLSKHLRIHAGHKPHVCPLCPRSFVAKADLQRHVLVHSGIKPYSCHRCPATFRRRDKLLKHEARHEAIGSEKCHSFDKTEETHDMVVSINPFSNIMTSPIDMHTESATTNYDLPRIPDHISGESSFTKIQKSSGATNKQVPISPPKKVNKNRPKNIKCHQCPKRFSSLDAYKTHVSIAHMGSRVFQCKICFKKFARKRELDRHAALHTGMKPFSCNQCDKKFTKKDKLDKHEQTHECLVMNMPCIECGATFEKKADLVAHIKSHFTDNLHEKLSETEIKKEEEPEYTVDDNFYNLET

Similar Transcription Factors

Sequence clustering based on sequence similarity using MMseqs2

100% Identity: iTF_00187384;
90% Identity: iTF_00113518; iTF_00112697; iTF_00114298; iTF_01316602; iTF_01317536;
80% Identity: -