Sric009569.1
Basic Information
- Insect
- Samia ricini
- Gene Symbol
- -
- Assembly
- None
- Location
- BLXV01000008:7019989-7028076[+]
Transcription Factor Domain
- TF Family
- zf-C2H2
- Domain
- zf-C2H2 domain
- PFAM
- PF00096
- TF Group
- Zinc-Coordinating Group
- Description
- The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [1].
- Hmmscan Out
-
# of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc 1 10 8.4e-07 5.5e-05 23.6 0.2 3 23 130 150 129 150 0.98 2 10 4.7e-05 0.0031 18.1 0.6 2 23 156 177 155 177 0.97 3 10 2e-07 1.3e-05 25.5 1.0 1 23 183 205 183 205 0.97 4 10 5.4e-05 0.0035 17.9 0.8 1 20 211 230 211 232 0.95 5 10 0.00033 0.022 15.4 0.9 2 23 244 265 243 265 0.97 6 10 9.4e-05 0.0061 17.1 2.4 1 23 271 293 271 293 0.97 7 10 8.7e-06 0.00057 20.4 4.2 1 23 299 321 299 321 0.99 8 10 2e-05 0.0013 19.2 6.5 1 23 327 349 327 349 0.98 9 10 0.00082 0.054 14.2 2.3 2 23 356 377 355 377 0.97 10 10 0.00016 0.01 16.4 3.7 1 23 384 407 384 407 0.96
Sequence Information
- Coding Sequence
- atgtcaaccgaccatattatgaacgttataattaaaatagaacctaaggaggaaacgtcaaatgaagaggacaacgatttagggaattacgaacagaaaatatttgccactgagaagagaattaaagaagaacgtattgattacaacatatcttggtctccaccagattcagctgatcaggaatcttcactcccttgtgacagtgggcaaccatggccattcgtgaaaatagaagaacaaggaattgaacaattggaaacggacagtgcgttaaagattgaagataatccgtatacggaatcaattgatatacggccagatgtttcaactgctaatatatcacaatatgatccctcacaattgaatataaatttcgagaaaaacttatgccccatatgcaataaacggtttgccaattccggcaacgtgcagcgccacatgctcatccacaatagaacgaaactacagtgtccgaactgtaataaagagttcctgcaagagagccaactggcaaagcacatgaccaaacacggaacacctagaatcttcgcctgcaacgattgcgggaagagattcgcgaataattctaaactcaagcagcattcgagggtgcatttgatcgtgaagccgtactcttgtaccgtttgccatcggacatttgcgacggagcaatacttaataagacatcaagggaagagtcgctgcaaacggccgatagaccaaccagtcacatgccctgtctgctttataagcttcgctaaagagtttcaactaaagcgtcactcgaagaagcatgacactgtgaaaccatactgctgcgacacctgtggcgttagtttcaaatacaagagcacaatgatcaagcacgtccaatggcacagtggcttgaaaccatacgtgtgcaaattctgcaacaagtgcttcagtaactacagtatgctgaagcctcacatgagggtgcatacaggcgagaaaccgtaccaatgcgtgatctgccagaagatgttttcccacaagcacaacatgcaaaggcacacgttaaggcatgcgaaggagaagaatctcacctgcaatatatgctgcaagaagttcccgagggagagtagactgatttaccacatgcggatccatttggacgataaaggattctttccgtgcaacgtttgcacgaagaagttctcgcataagcaaaacgtcctgagacactatgcgaggaagcatccggggcatacttaccatagcactgatacggatgctaaagtggcggtcagggtgtgggatactgttcgcagtcaactcaaactggatgagcctgaagagattttgagttatacctaa
- Protein Sequence
- MSTDHIMNVIIKIEPKEETSNEEDNDLGNYEQKIFATEKRIKEERIDYNISWSPPDSADQESSLPCDSGQPWPFVKIEEQGIEQLETDSALKIEDNPYTESIDIRPDVSTANISQYDPSQLNINFEKNLCPICNKRFANSGNVQRHMLIHNRTKLQCPNCNKEFLQESQLAKHMTKHGTPRIFACNDCGKRFANNSKLKQHSRVHLIVKPYSCTVCHRTFATEQYLIRHQGKSRCKRPIDQPVTCPVCFISFAKEFQLKRHSKKHDTVKPYCCDTCGVSFKYKSTMIKHVQWHSGLKPYVCKFCNKCFSNYSMLKPHMRVHTGEKPYQCVICQKMFSHKHNMQRHTLRHAKEKNLTCNICCKKFPRESRLIYHMRIHLDDKGFFPCNVCTKKFSHKQNVLRHYARKHPGHTYHSTDTDAKVAVRVWDTVRSQLKLDEPEEILSYT
Similar Transcription Factors
Sequence clustering based on sequence similarity using MMseqs2
- 100% Identity
- -
- 90% Identity
- -
- 80% Identity
- -