Sric014383.1
Basic Information
- Insect
- Samia ricini
- Gene Symbol
- -
- Assembly
- None
- Location
- BLXV01000005:2769376-2781508[-]
Transcription Factor Domain
- TF Family
- zf-C2H2
- Domain
- zf-C2H2 domain
- PFAM
- PF00096
- TF Group
- Zinc-Coordinating Group
- Description
- The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [1].
- Hmmscan Out
-
# of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc 1 12 8.7e-05 0.0057 17.2 2.6 1 23 264 287 264 287 0.96 2 12 0.0012 0.077 13.7 3.2 1 23 297 319 297 319 0.98 3 12 2e-05 0.0013 19.2 1.5 2 23 326 347 325 347 0.96 4 12 1.6e-05 0.0011 19.5 0.4 1 23 353 375 353 375 0.98 5 12 8.2e-05 0.0054 17.3 0.9 1 23 384 406 384 406 0.97 6 12 1.9e-05 0.0012 19.3 0.1 1 23 412 434 412 434 0.98 7 12 0.00044 0.029 15.0 7.6 1 23 440 462 440 462 0.98 8 12 3.4e-09 2.2e-07 31.1 1.3 1 23 468 490 468 490 0.99 9 12 5e-05 0.0033 18.0 1.5 1 23 496 518 496 518 0.99 10 12 0.00012 0.008 16.8 0.3 1 23 524 545 524 545 0.96 11 12 0.00014 0.0092 16.6 0.4 1 23 551 573 551 573 0.97 12 12 1.2e-05 0.00079 19.9 4.3 1 23 579 601 579 601 0.98
Sequence Information
- Coding Sequence
- atgaatgttgatagtattgaaatcaaaatgggagatgaggataaatctatgaatctaattgacgagggttcaattgaaatacctttccaccttttcgagtttctcagcacaccccactccaatacacaaagtgtgtgtcggatatgcttctctactgataataaaattatgtttcctctatattcttcaaaagaatcgggcatgtttgcaactatgtttacagctttaacagcgatagagatttaccctggtgatgatcttccagctaatgtatgtaaatcatgccaaactcagatagtgagctgttataaatttaaagtgcaatgtgaaaaagcgactagtatactgaaatcagtattgaaatgtttgaggaaagtaaaaccagttgacaacaatattagccctgaggatgttcccgagtggcataatacagaaataaaaaaagaatgtgatattttaaattcagaaggtatacaaaatagacatgatgttattcctaatacaaataatgatgtatgtatgctgacaaaaacagagaaaaattcttcagcattagttacggagattaataatccaaaagctatagagataaaaaaggaatttaacaatttaaaactggaagatgcagaatatttagatgatgtaatatgtaataagaattatactctatgtactgacataaaaaaacaaaagagaaaaaaagtcactatatctgttacagattcgaatacacttctaaatggcattgttagtaaaaaaaactcctctaagaaaaatagacgtaaatgttactcatgtaaatattgcaataagaaatttaacaaaataaaattattgagagctcatttaaataataatcatccgaaaacacagaaaatagatctagaatattcatgcagtcactgtaatgactcgtttagttccgagcatgatctaaacctgcacttgatgttgcatacaaaaggaccgaaatggagatgtaatcaatgtgaaaaaatatttcaatcaaagtcactattgcgacgtcacatctaccggcacatggaatcgaagcgctactcgtgcgacacatgcgggaaactgttcactgaactatacgcgctgcggcgacacgcgcgcgtacacaccggcgagatcgtagagaagaaacacgagtgtcatctctgtgataaaaaatacagtgaaagtggtctcctggcagcacatatagcgcggcatgaaggattccgcccttacgtttgttccgattgcgggaaagcgttcccttcgacccgtctcctctcttcacatgcactaacgcactctgacaacaagccttatgcctgcacatactgcgacaaacggtttagacacgagtcgacgaggaatacccatcaccgaactcacaccggtgagaaaccatacgtgtgctcgacttgcgggaaaacattcatacagaactctaacctaaaactgcatatgcgaacacatacgggagaaaagccgtattcttgttcgatatgcaatcgcaagttctcatctggatcttctgtgaaaacgcacgaacgcacccacactggggaacgtccgtataaatgcgaaatttgcgggaaaaggtttgcccgtgtgaatatgagagcgcatatgttattgcataccggggagcgtccgtacgcttgcagtatgtgccctaaaaagtttgtaaacgctacaagactacgagatcactcccgcgtacatactggtgaaaaacctttcgaatgtgaaaactgctcgcaaaaattccaaacgaaatctcatttattgaggcacattaaaacacacgataagggaaagaaatctagcaaactaaaagcatacagttccgaattaacacttcctaatatacaacattcaaaaagttctgataatatcgataatgacttgagtattattaaagatcaacaagaaagagatacaaatatggaagaagaatgtagaacgattgtgtttaatatagaggaggtacctttagaagtcaacggagaattggtacttcaaggtgagagtaaggttaaaacggaaatgctggtaatcgatggcagccatgactatcagaccgagaatattcttaacactaacggcgtcattgtcagtgatataaattacgctaataatcttgtgcctgtgaacgaaatcgatgggactgtaacgacctcagagactgttctagaaggagcgacagtcaaactgtatcaattggaccaaagtttactacaaatacacagcgctggcggccagttgactattagtaaaatcactagcaaaatgactgcaaacttttaa
- Protein Sequence
- MNVDSIEIKMGDEDKSMNLIDEGSIEIPFHLFEFLSTPHSNTQSVCRICFSTDNKIMFPLYSSKESGMFATMFTALTAIEIYPGDDLPANVCKSCQTQIVSCYKFKVQCEKATSILKSVLKCLRKVKPVDNNISPEDVPEWHNTEIKKECDILNSEGIQNRHDVIPNTNNDVCMLTKTEKNSSALVTEINNPKAIEIKKEFNNLKLEDAEYLDDVICNKNYTLCTDIKKQKRKKVTISVTDSNTLLNGIVSKKNSSKKNRRKCYSCKYCNKKFNKIKLLRAHLNNNHPKTQKIDLEYSCSHCNDSFSSEHDLNLHLMLHTKGPKWRCNQCEKIFQSKSLLRRHIYRHMESKRYSCDTCGKLFTELYALRRHARVHTGEIVEKKHECHLCDKKYSESGLLAAHIARHEGFRPYVCSDCGKAFPSTRLLSSHALTHSDNKPYACTYCDKRFRHESTRNTHHRTHTGEKPYVCSTCGKTFIQNSNLKLHMRTHTGEKPYSCSICNRKFSSGSSVKTHERTHTGERPYKCEICGKRFARVNMRAHMLLHTGERPYACSMCPKKFVNATRLRDHSRVHTGEKPFECENCSQKFQTKSHLLRHIKTHDKGKKSSKLKAYSSELTLPNIQHSKSSDNIDNDLSIIKDQQERDTNMEEECRTIVFNIEEVPLEVNGELVLQGESKVKTEMLVIDGSHDYQTENILNTNGVIVSDINYANNLVPVNEIDGTVTTSETVLEGATVKLYQLDQSLLQIHSAGGQLTISKITSKMTANF
Similar Transcription Factors
Sequence clustering based on sequence similarity using MMseqs2
- 100% Identity
- -
- 90% Identity
- -
- 80% Identity
- -