Sric006639.1
Basic Information
- Insect
- Samia ricini
- Gene Symbol
- -
- Assembly
- None
- Location
- BLXV01000013:5226812-5228431[+]
Transcription Factor Domain
- TF Family
- zf-C2H2
- Domain
- zf-C2H2 domain
- PFAM
- PF00096
- TF Group
- Zinc-Coordinating Group
- Description
- The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [1].
- Hmmscan Out
-
# of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc 1 17 4.4e-05 0.0029 18.2 4.9 1 23 9 32 9 32 0.96 2 17 0.0068 0.45 11.3 1.3 2 23 36 58 35 58 0.95 3 17 1.1e-05 0.00069 20.1 0.1 2 23 67 89 67 89 0.97 4 17 2.2e-05 0.0014 19.1 1.0 2 23 98 120 97 120 0.94 5 17 0.00079 0.052 14.2 1.0 2 23 128 150 127 150 0.94 6 17 3.9e-06 0.00026 21.5 0.9 2 23 158 180 157 180 0.96 7 17 5.7e-06 0.00037 20.9 1.8 1 23 186 209 186 209 0.97 8 17 7.3 4.8e+02 1.7 0.8 2 23 218 240 217 240 0.85 9 17 2.3 1.5e+02 3.3 0.1 7 23 267 284 262 284 0.92 10 17 6.9e-05 0.0045 17.5 3.3 1 23 299 322 299 322 0.97 11 17 4.1 2.7e+02 2.5 0.5 2 21 330 349 329 350 0.85 12 17 0.0007 0.046 14.4 2.1 2 23 359 381 359 381 0.97 13 17 0.00023 0.015 15.9 5.6 1 23 404 427 404 427 0.97 14 17 1.9e-06 0.00012 22.5 0.7 2 23 434 456 433 456 0.96 15 17 3.7e-05 0.0024 18.4 3.7 2 23 463 485 462 485 0.94 16 17 0.00052 0.034 14.8 2.7 1 23 491 514 491 514 0.98 17 17 0.047 3.1 8.6 0.1 2 13 522 533 522 537 0.79
Sequence Information
- Coding Sequence
- atgtataattgcaaatcattagattatacatgtgactactgtagcagaaaatttatgaggaaatataatctgcagactcacatagagaactgtcacataaactgctattgtgaattttgcggacagacgtgtggcagtccggccggattgcagctccatttatcccgcgggcataatcggcattcgcaaccgtttccagaatgcgacatttgcggacgtattttcacaaggaagcaaaatatagtgtcccatatgatcactatacattcacaaggcatacgtccaaagatacgttgcagaatgtgttctaaatcatttgcaaccgagaggaatcttaaaaggcatgtcaatctgcttcataacccagatgtagaatattcaacgtgtgacaagtgtaataaaatatttaaaggtaaacaatccctattagctcataatcagagcatgcataattctgatcacggaacgaatcagtgtaatttgtgtgaaaaagtttatacaaataatcgaaacctcaagaagcatattgaggtgtttcaccgagaaaaacaagagttcagatgcgatctttgtcctaaagtgtacacttcaaatcgcagtcttagaaggcattcacgttctacacatgtttccgaagatcaagagcctctgaaatgtgacatatgttatcaattaatatttggtaagaagaatctctacagtcacgtccagttcttccataactcgcaagagaactgtagcaccaaggacatgagtgaaaataatctaaaaaccaaggatcttgtttgcgaaaagagcaacaaaacattcgataaggagcctcagttacgggagcatgtgaaaaacaatcattcattgttaaaacaaaagtcagaatcaaagaagcaagtgtttttctgctgcgaatactgtaccagttcattcacaagtgtttacgagttgaagaatcacatgagagtgaaccatgacaagaagtattcattgtccacatgcaacgtgtgtttcaatagattttacagtacagatacgattttggagcacaaaaaaatgtgtctaccgcctgataatgtcaacacttgcaatcattgcgataaattgtttacggatatatcaagtttggagtttcatatgaggatatttcatccacaatctcaaatagctgatactaatataacttcgacaaatactgatgatggagatggtagctcatacaggtgcagtcattgcaacagagcttactatagcgccagatctctaaaacaccacattaagttaaaacatacgacaggtgaacccgtggagtgttgttactgcggaaaaatttttagtaacaaatattatttggcatcacatataaagatcgtgcataacaatgacacttggtggaaatgcgattattgcgataaacagtttaaatctaaaagaaatatgcacagacatatcgaatatacacatttaggtatgcaaagatacaagtgtcttgaatgcgagacgctatttaaagagaaacgaaatatgagaaagcatgtgcggacgaaacacccgaattcagcgttgtttcctgaatgtcatatatgccacaaacgattcgaatcagcgaatcttgtaagattcatttga
- Protein Sequence
- MYNCKSLDYTCDYCSRKFMRKYNLQTHIENCHINCYCEFCGQTCGSPAGLQLHLSRGHNRHSQPFPECDICGRIFTRKQNIVSHMITIHSQGIRPKIRCRMCSKSFATERNLKRHVNLLHNPDVEYSTCDKCNKIFKGKQSLLAHNQSMHNSDHGTNQCNLCEKVYTNNRNLKKHIEVFHREKQEFRCDLCPKVYTSNRSLRRHSRSTHVSEDQEPLKCDICYQLIFGKKNLYSHVQFFHNSQENCSTKDMSENNLKTKDLVCEKSNKTFDKEPQLREHVKNNHSLLKQKSESKKQVFFCCEYCTSSFTSVYELKNHMRVNHDKKYSLSTCNVCFNRFYSTDTILEHKKMCLPPDNVNTCNHCDKLFTDISSLEFHMRIFHPQSQIADTNITSTNTDDGDGSSYRCSHCNRAYYSARSLKHHIKLKHTTGEPVECCYCGKIFSNKYYLASHIKIVHNNDTWWKCDYCDKQFKSKRNMHRHIEYTHLGMQRYKCLECETLFKEKRNMRKHVRTKHPNSALFPECHICHKRFESANLVRFI
Similar Transcription Factors
Sequence clustering based on sequence similarity using MMseqs2
- 100% Identity
- -
- 90% Identity
- -
- 80% Identity
- -