Sric008876.1
Basic Information
- Insect
- Samia ricini
- Gene Symbol
- -
- Assembly
- None
- Location
- BLXV01000008:7425863-7433070[+]
Transcription Factor Domain
- TF Family
- zf-C2H2
- Domain
- zf-C2H2 domain
- PFAM
- PF00096
- TF Group
- Zinc-Coordinating Group
- Description
- The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [1].
- Hmmscan Out
-
# of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc 1 14 0.35 23 5.9 4.8 2 21 120 139 120 140 0.93 2 14 0.00052 0.034 14.8 0.6 2 23 147 168 146 168 0.96 3 14 4.4e-06 0.00029 21.3 2.9 1 23 174 196 174 196 0.98 4 14 1.6e-06 0.00011 22.7 0.8 1 23 202 224 202 224 0.97 5 14 0.00013 0.0084 16.7 1.2 1 21 230 250 230 251 0.95 6 14 1.4e-05 0.00092 19.7 0.4 1 23 258 280 258 280 0.95 7 14 0.038 2.5 8.9 5.1 1 19 286 304 286 307 0.93 8 14 5.2e-05 0.0034 17.9 2.0 1 23 366 388 366 388 0.98 9 14 0.17 11 6.9 4.8 1 21 393 413 393 415 0.89 10 14 6.8e-06 0.00045 20.7 0.8 1 23 421 443 421 443 0.98 11 14 6.7e-06 0.00044 20.7 4.3 1 23 448 470 448 470 0.98 12 14 1.8e-07 1.2e-05 25.6 0.3 1 23 476 498 476 498 0.98 13 14 7.1e-06 0.00047 20.6 1.8 1 23 504 526 504 526 0.97 14 14 6.8e-05 0.0045 17.6 0.7 1 21 532 552 532 553 0.94
Sequence Information
- Coding Sequence
- atgtcatcatcaattttcactaacataacaacaaaagaagaacctaaatgggatgatggtaaacagtgtgagaacatagaacctgacataggtgtggtatataatactattgtgataaaggtagaaaaaactgaagatgaatatgtagctgataatgatgtatatcctcctgtggaggtaaagctagaggagtttgatggtgtgttaaatgctgataataatctatgtgaagaaccgcaagatctctccttaccgacaataaggcgaaataaagtaaatttaaggaaaactaaattaaaaaatgatgataatcaaagcctcaaagaggccaccacaatatcatctgtcaacgacagaacttgttccacttgtcacagagagtttcagactgaaagaaaattgaaagtacataaatgcagcccactcgaccagtcgatatattgtgcgttatgtgataaatatttcgcagcgaaatcgacactagtgcatcacatgctaaatcatagtggcgagcaaagatttcagtgtaaagtgtgcttcaagtcctttaattatagctcgagtttaaaagaacatgagagatcccatactggtgaaaggccgttctcatgtagtatttgcaataaaaaattccccagaaaggcgagcttaacagttcacgagagactgcataaaaacatcaggccgtacagttgcaaagtttgcgagaaaagttttaacagcggtggaaatttgtccagacatagatgcattaacccccccgagaaaaaatataaatgtcctttatgccctaaagtgtttacttatagagaaagtttagtctctcattcttatgttcatacggacatgacccctttcaagtgtcaatactgtgggaaaaattattcagcaaagcgctgcctcttggcccataattgtaaaagctctgtaaaatctaacaagattgaaaataatgctaatgaaaaacaaaataattccattaaatataataatgttaatgaaaaaattagcattggagcaatggatatgagtaatataagtcgagatacaaatatcacagaagctaatacagttatattaaagagaaatggtgtttactcttgtgaattatgttcgagatcgttttacgattcggaaaaattaaaacagcacatattcaaacacaattataaacttttcacatgtgacgtttgcaaaaagagtttcactgcaaaaccgacattgatttgccatttaagatgtcatttcggtgagaagccgtacgcgtgtaccgtttgcgagaagaaattctacaacagggctggtctgaaggaacacttgagaaagcataacggggaaaagtatacttgtaagacttgtaacaagtgtttcgcaaacagatcctctctgctggtgcactccagatctcatacaggcgtgaagccattcagctgcgagatatgcggcaaatcattcgtggatagttcagggattataaggcacaggcgaactcataacaaagagaagcccttcgtctgccagtactgcccgaaatcatatgcaaataaaacaaattataactcccatatgtataatcattgtgggcagaagccgcatgtttgcgataactgcgggaagagttttgcagttaaatataaattaacatatcatattagtaaatgtaagaagaaatcttag
- Protein Sequence
- MSSSIFTNITTKEEPKWDDGKQCENIEPDIGVVYNTIVIKVEKTEDEYVADNDVYPPVEVKLEEFDGVLNADNNLCEEPQDLSLPTIRRNKVNLRKTKLKNDDNQSLKEATTISSVNDRTCSTCHREFQTERKLKVHKCSPLDQSIYCALCDKYFAAKSTLVHHMLNHSGEQRFQCKVCFKSFNYSSSLKEHERSHTGERPFSCSICNKKFPRKASLTVHERLHKNIRPYSCKVCEKSFNSGGNLSRHRCINPPEKKYKCPLCPKVFTYRESLVSHSYVHTDMTPFKCQYCGKNYSAKRCLLAHNCKSSVKSNKIENNANEKQNNSIKYNNVNEKISIGAMDMSNISRDTNITEANTVILKRNGVYSCELCSRSFYDSEKLKQHIFKHNYKLFTCDVCKKSFTAKPTLICHLRCHFGEKPYACTVCEKKFYNRAGLKEHLRKHNGEKYTCKTCNKCFANRSSLLVHSRSHTGVKPFSCEICGKSFVDSSGIIRHRRTHNKEKPFVCQYCPKSYANKTNYNSHMYNHCGQKPHVCDNCGKSFAVKYKLTYHISKCKKKS
Similar Transcription Factors
Sequence clustering based on sequence similarity using MMseqs2
- 100% Identity
- -
- 90% Identity
- -
- 80% Identity
- -