Basic Information

Transcription Factor Domain

TF Family: HTH
Domain: HTH_psq domain
PFAM: PF05225
TF Group: Helix-turn-helix
Description: This DNA-binding motif is found in four copies in the pipsqueak protein of Drosophila melanogaster [1]. In pipsqueak this domain binds to GAGA sequence [1].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 4 0.037 49 3.9 0.0 29 40 5 17 3 18 0.89

2 4 0.047 63 3.6 0.0 29 39 22 33 21 36 0.91

3 4 0.0023 3 7.8 0.0 27 39 37 50 33 52 0.89

4 4 0.0022 2.9 7.8 0.0 27 39 54 67 50 70 0.89

#	of	c-Evalue	i-Evalue	score	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	4	0.037	49	3.9	29	40	5	17	3	18	0.89
2	4	0.047	63	3.6	29	39	22	33	21	36	0.91
3	4	0.0023	3	7.8	27	39	37	50	33	52	0.89
4	4	0.0022	2.9	7.8	27	39	54	67	50	70	0.89

Coding Sequence: ATGTTATCTACACCCAACAACACACTACAACCAAACTATTACCAACAATCCATGTTACCTACACCCAACAACACACTACAACCAAACCACTATCAACAATCCGCATTATCTATACCCAACAACACACTACAACCTAACCACTATCAACAATCCGCATTATCTATACCCAACAACACACTACAACCTAACCACTATCAACAATCCGCATTATCTACACCCAACAACACACAACAACCAAACTATTATGAACCATCCGCGTTACCTACACCCAGCAACACACAACAATCAAACAACCATCAACAACAATCCATGTTATCTACACACAACACACAATAA
Protein Sequence: MLSTPNNTLQPNYYQQSMLPTPNNTLQPNHYQQSALSIPNNTLQPNHYQQSALSIPNNTLQPNHYQQSALSTPNNTQQPNYYEPSALPTPSNTQQSNNHQQQSMLSTHNTQ

Sequence clustering based on sequence similarity using MMseqs2