Basic Information

Insect: Perizoma affinitatum
Gene Symbol: -
Assembly: GCA_961405105.1
Location: OY560188.1:3579723-3580829[-]

Transcription Factor Domain

TF Family: zf-C2H2
Domain: zf-C2H2 domain
PFAM: PF00096
TF Group: Zinc-Coordinating Group
Description: The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [1].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 9 0.0019 0.12 13.3 0.8 2 23 82 104 81 104 0.90

2 9 0.023 1.5 9.9 2.4 2 23 127 149 126 149 0.91

3 9 0.00011 0.0072 17.2 0.1 1 23 156 179 156 179 0.95

4 9 0.00043 0.028 15.3 1.4 2 23 185 207 184 207 0.97

5 9 0.0012 0.076 14.0 0.1 2 23 213 235 212 235 0.95

6 9 0.00077 0.05 14.5 1.1 1 23 242 265 242 265 0.96

7 9 0.0031 0.2 12.6 1.5 1 23 271 293 271 293 0.94

8 9 1.6e-05 0.001 19.8 2.8 1 23 299 321 299 321 0.99

9 9 1e-06 6.7e-05 23.6 1.7 1 23 327 349 327 350 0.95

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	9	0.0019	0.12	13.3	0.8	2	23	82	104	81	104	0.90
2	9	0.023	1.5	9.9	2.4	2	23	127	149	126	149	0.91
3	9	0.00011	0.0072	17.2	0.1	1	23	156	179	156	179	0.95
4	9	0.00043	0.028	15.3	1.4	2	23	185	207	184	207	0.97
5	9	0.0012	0.076	14.0	0.1	2	23	213	235	212	235	0.95
6	9	0.00077	0.05	14.5	1.1	1	23	242	265	242	265	0.96
7	9	0.0031	0.2	12.6	1.5	1	23	271	293	271	293	0.94
8	9	1.6e-05	0.001	19.8	2.8	1	23	299	321	299	321	0.99
9	9	1e-06	6.7e-05	23.6	1.7	1	23	327	349	327	350	0.95

Sequence Information

Coding Sequence: ATGTCCGAACTGCAACGAAAGGAAGACCTCGTGAGTCTCATGTCTTCCATCATTGAAAACTCCACGGCTGTACCCTTCAGGTGGCATTGCAGCAAATTCGCCTGCTTCTTCTGCTGCTTTCCTTTCGAAGAGAGCTCAAAACTCAAAGCTCACTACCACGAGGAACACAGCGACGCAAAAATAAGAAGCGCATTTCGGGGCGTCATCAAAAATAGCAAAGTGAAGCTGGAAATCTCGAATCTAACTTGCAAGAAGTGTTCTAAAAGTTTCACTGTCCTAAACGACTTGCTGGACCATTTCGTCAAAATTCACGCTCTCAAACTCAATCTTGAAGTAAAACATCAGATCTTCGCTTACAAACTTTCGGATGAAATGATGCCGTGCCTGCATTGCGGAGAGGAGTTTCGATTCTTCGGTACCTTACTCAAGCACACTCACGCGAAGCACAATACGACGAACGAAGCTTTCTTGTGCGAGATTTGCGGACAAGCATTCGTTACAAAGACGAGCGTAGCCAGCCACGTGAAGACTGTACATTCTCAAGACAACGTGACCTGCGAGAAGTGCAACATAGCGTTCAAAAATGTGAACGCGTTGCAGCTTCATCATCGGCGAACGCACAAAACCTACATGTTGAAATGTCCGAAATGCCCAGAGGTTTTGACCAGCCCCTATCTAAGAAAGCGGCATCTGGCCAAAGTTCATGACGTCAAACGCTTCCAATACGAATGCGATCAGTGCAATTTCGTGTTCACGCTGAAGAGTCGTCTTATCTCGCACAAGTCGCGCGTTCATATGAAGGAGAGGAGTTACAACTGTGAGTTTTGTTCGTACAAGGCTTTTAACAAAGAGAGCTTGACGCGGCACATGGTGTCGCACGACGACTCTCGCCCATTCCAGTGTGAGTTTTGCAAGAAAGCTTTTCAGAGGAAGAAAACGTTGGAACTCCATAGGAGGATCCATACGAACGATAGGAGGTATGCGTGTAAGGAGTGTGGCAAGGCATTTGTGCAGTACACGAGTCTGAAGCTACATTACAGAGTGCATCATTCTAAAGAAGGACCATCTGCGCTGGATGTTGCCGGCCACTGGCTGCCTAGACACTGA
Protein Sequence: MSELQRKEDLVSLMSSIIENSTAVPFRWHCSKFACFFCCFPFEESSKLKAHYHEEHSDAKIRSAFRGVIKNSKVKLEISNLTCKKCSKSFTVLNDLLDHFVKIHALKLNLEVKHQIFAYKLSDEMMPCLHCGEEFRFFGTLLKHTHAKHNTTNEAFLCEICGQAFVTKTSVASHVKTVHSQDNVTCEKCNIAFKNVNALQLHHRRTHKTYMLKCPKCPEVLTSPYLRKRHLAKVHDVKRFQYECDQCNFVFTLKSRLISHKSRVHMKERSYNCEFCSYKAFNKESLTRHMVSHDDSRPFQCEFCKKAFQRKKTLELHRRIHTNDRRYACKECGKAFVQYTSLKLHYRVHHSKEGPSALDVAGHWLPRH

Similar Transcription Factors

Sequence clustering based on sequence similarity using MMseqs2

100% Identity: iTF_00701390;
90% Identity: iTF_01171743;
80% Identity: -