Basic Information

Transcription Factor Domain

TF Family: zf-C2H2
Domain: zf-C2H2 domain
PFAM: PF00096
TF Group: Zinc-Coordinating Group
Description: The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [1].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 7 0.021 2.1 9.4 1.9 2 21 5 24 4 25 0.93

2 7 5.5e-05 0.0056 17.5 1.3 3 21 50 68 48 69 0.93

3 7 8.3e-05 0.0086 17.0 1.1 2 20 77 95 76 97 0.94

4 7 0.00022 0.022 15.7 3.3 1 21 135 155 135 156 0.96

5 7 0.031 3.2 8.9 2.3 1 23 164 187 164 187 0.97

6 7 0.00045 0.046 14.7 3.5 1 21 223 243 223 244 0.95

7 7 9.6e-05 0.0099 16.8 1.0 1 23 252 275 252 275 0.98

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	7	0.021	2.1	9.4	1.9	2	21	5	24	4	25	0.93
2	7	5.5e-05	0.0056	17.5	1.3	3	21	50	68	48	69	0.93
3	7	8.3e-05	0.0086	17.0	1.1	2	20	77	95	76	97	0.94
4	7	0.00022	0.022	15.7	3.3	1	21	135	155	135	156	0.96
5	7	0.031	3.2	8.9	2.3	1	23	164	187	164	187	0.97
6	7	0.00045	0.046	14.7	3.5	1	21	223	243	223	244	0.95
7	7	9.6e-05	0.0099	16.8	1.0	1	23	252	275	252	275	0.98

Coding Sequence: ATGAACACGGTGCGATGTTCGCAATGCGGCAAGGCGTTTCTCAAGCATAGGGACTTGACCTACCATTTGAAGCACGCGTGCGATCAGAAAGCCAAGATTCGTGGTGTGAAACGCGCAACTGTATTTCACTATGCGAGCAATTTGGACTGCGTTCAATGCGGGAAGAGGTTTAAAAGACGGAAAGATCTTAATTATCACGTTCGTCATTTGTGCGGAATAAAAGGGATACAGTGTCCTTACTGCAACAAGTGTTACACGTACACCTCTAACGTTAAATATCATATAAGTGATTCCCGTGGAGAGCACTTGTACAAAGGGAACGACGCGGACTTTGTTAACTATTTGCCGGAGATGAAAAGCCTGTTGAATAGGTACAGATATCACGCGAACGAGCGTAAGAGATTCGAGTGCCTGAACTGCGGCTGCCGTTTCACACAGAAGACGACGATGACGAGGCATCTGCGGTACTTTTGCGGCCAAGGACATCGCTACCAGTGCCCTTACTGCGAAATGAAAGCATCGTGCTCGTCTAACATTTACAGACACGTTCGATCGAGACACATTGGATACGAAGCTCGCGCCATTAAGCTCTTCTCCCCGATGAATCCACGTGCTTGCCGGACCGTTCCCAGAAGACGACGGAAAGTGTACTCCGTGAACAAGAGCCACTATTGCCCGCGCTGCAATCGTGGCTTCACCTTAAAGAAAAACATGACGCGACATCTGCGTCACGAGTGCGGCATGGCGCCGAAATACCAATGTCCTTACTGCGACAAGCCCTCCAAGTTTACCCAGAATATTTACGCCCACATCAGGAAGTATCATCCTGGTCAGACGCTCTGCTTCAAACGGCTCTACTGA
Protein Sequence: MNTVRCSQCGKAFLKHRDLTYHLKHACDQKAKIRGVKRATVFHYASNLDCVQCGKRFKRRKDLNYHVRHLCGIKGIQCPYCNKCYTYTSNVKYHISDSRGEHLYKGNDADFVNYLPEMKSLLNRYRYHANERKRFECLNCGCRFTQKTTMTRHLRYFCGQGHRYQCPYCEMKASCSSNIYRHVRSRHIGYEARAIKLFSPMNPRACRTVPRRRRKVYSVNKSHYCPRCNRGFTLKKNMTRHLRHECGMAPKYQCPYCDKPSKFTQNIYAHIRKYHPGQTLCFKRLY

Sequence clustering based on sequence similarity using MMseqs2