Mcic003312.1
Basic Information
- Insect
- Mochlonyx cinctipes
- Gene Symbol
- -
- Assembly
- GCA_001014845.1
- Location
- JXPH01007216.1:1-6468[-]
Transcription Factor Domain
- TF Family
- TF_bZIP
- Domain
- bZIP domain
- PFAM
- AnimalTFDB
- TF Group
- Basic Domians group
- Description
- bZIP proteins are homo- or heterodimers that contain highly basic DNA binding regions adjacent to regions of α-helix that fold together as coiled coils
- Hmmscan Out
-
# of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc 1 2 4e-05 0.039 14.2 2.1 32 57 28 53 22 60 0.90 2 2 8.6e-06 0.0084 16.3 5.3 31 63 64 96 57 98 0.85
Sequence Information
- Coding Sequence
- AACTTAGATAGTTGCTGGATACAAAGATTTAGTTGCGAAATTGGAGGGAGAGCTATTGGCCGTAAAATCGTTGCCAGAAGAAACGAAATCGATTCGTTGAGCTCTGAGAACGACAGGTTGAGGAAACGTAAAGAAGAGTTGGAGTTGGAGCTGGAAACGTTCACAACGGCTGAAGCGTATGAGGCTCACAAAAGTCAAGTTGAAAAGTTGCAGGCTCAAGTTGAGAGGTTGAAGATGAAGGTCCAAAAATTGGAAGAAGGGAACGAAGAGTTGACCGCTAAACTTAGCGATACCAGTATGACTACGAATTTGAAGGACATCAACGCACTAC
- Protein Sequence
- NLDSCWIQRFSCEIGGRAIGRKIVARRNEIDSLSSENDRLRKRKEELELELETFTTAEAYEAHKSQVEKLQAQVERLKMKVQKLEEGNEELTAKLSDTSMTTNLKDINAL
Similar Transcription Factors
Sequence clustering based on sequence similarity using MMseqs2
- 100% Identity
- -
- 90% Identity
- -
- 80% Identity
- -