Mdil008799.1
Basic Information
- Insect
- Megalocaria dilatata
- Gene Symbol
- GIS1
- Assembly
- GCA_034642435.1
- Location
- CM067855.1:69826044-69830399[+]
Transcription Factor Domain
- TF Family
- zf-C2H2
- Domain
- zf-C2H2 domain
- PFAM
- PF00096
- TF Group
- Zinc-Coordinating Group
- Description
- The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [1].
- Hmmscan Out
-
# of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc 1 8 0.00073 0.082 14.5 0.3 2 23 158 180 157 180 0.94 2 8 7.2e-05 0.0081 17.7 0.6 1 23 186 208 186 208 0.98 3 8 0.00014 0.016 16.8 4.7 1 23 214 236 214 236 0.95 4 8 1e-05 0.0011 20.4 1.8 1 23 242 264 242 264 0.98 5 8 0.00073 0.082 14.5 0.3 2 23 396 418 395 418 0.94 6 8 7.2e-05 0.0081 17.7 0.6 1 23 424 446 424 446 0.98 7 8 0.00014 0.016 16.8 4.7 1 23 452 474 452 474 0.95 8 8 1e-05 0.0011 20.4 1.8 1 23 480 502 480 502 0.98
Sequence Information
- Coding Sequence
- atggagaataatagtgatgtccatttttctcaactagaacagaatgttcatgaacggacagattcttttctatgtgaaaaatgcggaatgatcctttactcggaaatttcatttcatttccatctgcaatattaccatcataaacccttattcaataaatggagttctcttatagatgagtgtttgcaaactgaagtttccccaaatgcaacgaaccttgacgtcttaccgacggaaacgttcggtaacattgtcgaaatgccaaaagacttcaacaagaaaaacttcgatgataactgttcgatgaaggggaataatggcttggcgtacaagtataatgtcacaaacgaagtgaaatggattgataataccaaaaatcccacgcaagttcttccaacgattcaaaatatccattcgttaagcagcaatgatcaacttatttcaattaaagaaaatgttatgtgtgatttagtctgcgtgatatgtaataaaatcttcagcaaggccatgtatctcactcaacacaataaaagtattcactctggtgaaaagcccttcaaatgtaaacgttgtggaaagagataccaagacaacgatgcatatgaaatacacatcgccaagcatggagatgataagcctcacaaatgctcaaattgcgaaaaaagtttcaattacaaggccgacttaaagagacacaagtatttacacgcagctataaagccattctcttgtgaagtatgtaataaagctttcataaggaacgatcatatgctgaaacatgtgaaatcacacatacgcagggcacataataagactagtggtgttggagggggaaatgagtgtttgcaaactgaagtttccccaaatgcaacgaaccttgacgtcttaccgacggaaacgttcggtaacattgtcgaaatgccaaaagacttcaacaagaaaaacttcgatgataactgttcgatgaaggggaataatggtatatttgtttacccatcagatgatatgaaccttcttccagattcttacacaggcttggcgtacaagtataatgtcacaaacgaagtgaaatggattgataataccaaaaatcccacgcaagttcttccaacgattcaaaatatccattcgttaagcagcaatgatcaacttatttcaattaaagaaaatgttatgtgtgatttagtctgcgtgatatgtaataaaatcttcagcaaggccatgtatctcactcaacacaataaaagtattcactctggtgaaaagcccttcaaatgtaaacgttgtggaaagagataccaagacaacgatgcatatgaaatacacatcgccaagcatggagatgataagcctcacaaatgctcaaattgcgaaaaaagtttcaattacaaggccgacttaaagagacacaagtatttacacgcagctataaagccattctcttgtgaagtatgtaataaagctttcataaggaacgatcatatgctgaaacatgtgaaatcacacatacgcagggcacataataagactagtggtgttggagggggaaatgagtgtttgcaaactgaagtttccccaaatgcaacgaaccttgacttcttaccgacggaaacgttcggtaacattgtcgaaatgccaaaagacttcaacaagaaaaacttcgatgataactgttcgatgaaggggaataatggtatatttgtttacccatcagatgatatgaaccttcttccagattcttacacaggcttggcgtacaagtataatgtcacaaagaagtga
- Protein Sequence
- MENNSDVHFSQLEQNVHERTDSFLCEKCGMILYSEISFHFHLQYYHHKPLFNKWSSLIDECLQTEVSPNATNLDVLPTETFGNIVEMPKDFNKKNFDDNCSMKGNNGLAYKYNVTNEVKWIDNTKNPTQVLPTIQNIHSLSSNDQLISIKENVMCDLVCVICNKIFSKAMYLTQHNKSIHSGEKPFKCKRCGKRYQDNDAYEIHIAKHGDDKPHKCSNCEKSFNYKADLKRHKYLHAAIKPFSCEVCNKAFIRNDHMLKHVKSHIRRAHNKTSGVGGGNECLQTEVSPNATNLDVLPTETFGNIVEMPKDFNKKNFDDNCSMKGNNGIFVYPSDDMNLLPDSYTGLAYKYNVTNEVKWIDNTKNPTQVLPTIQNIHSLSSNDQLISIKENVMCDLVCVICNKIFSKAMYLTQHNKSIHSGEKPFKCKRCGKRYQDNDAYEIHIAKHGDDKPHKCSNCEKSFNYKADLKRHKYLHAAIKPFSCEVCNKAFIRNDHMLKHVKSHIRRAHNKTSGVGGGNECLQTEVSPNATNLDFLPTETFGNIVEMPKDFNKKNFDDNCSMKGNNGIFVYPSDDMNLLPDSYTGLAYKYNVTKK
Similar Transcription Factors
Sequence clustering based on sequence similarity using MMseqs2
- 100% Identity
- -
- 90% Identity
- -
- 80% Identity
- -