Lbel012106.1
Basic Information
- Insect
- Lysandra bellargus
- Gene Symbol
- -
- Assembly
- GCA_905333045.1
- Location
- HG995320.1:17034519-17047239[-]
Transcription Factor Domain
- TF Family
- zf-C2H2
- Domain
- zf-C2H2 domain
- PFAM
- PF00096
- TF Group
- Zinc-Coordinating Group
- Description
- The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [1].
- Hmmscan Out
-
# of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc 1 10 0.027 2.2 9.6 0.1 2 20 8 26 8 28 0.93 2 10 0.027 2.2 9.6 0.1 2 20 37 55 37 57 0.93 3 10 0.027 2.2 9.6 0.1 2 20 66 84 66 86 0.93 4 10 0.027 2.2 9.6 0.1 2 20 95 113 95 115 0.93 5 10 0.027 2.2 9.6 0.1 2 20 124 142 124 144 0.93 6 10 0.9 74 4.8 0.0 2 23 184 206 183 206 0.90 7 10 1 82 4.6 4.3 1 20 218 237 218 240 0.84 8 10 1.4e-05 0.0011 19.9 2.1 1 23 246 268 246 268 0.97 9 10 9e-05 0.0074 17.3 1.3 1 23 275 298 275 298 0.98 10 10 0.00018 0.015 16.4 0.9 1 23 304 327 304 328 0.94
Sequence Information
- Coding Sequence
- ATGGTGAAACTAGAAGGTCCGTACTGCGAGGAGTGCAAGCTGCGGTTCGCCAGCGACGAGGCCTATCAGCGCCATCTCACGCAGTCCTCCGTGAAACTAGAAGGTCCGTACTGCGAGGAGTGCAAGCTGCGGTTCGCCAGCGACGAGGCCTATCAGCGCCATCTCACGCAGTCCTCCGTGAAACTAGAAGGTCCGTACTGCGAGGAGTGCAAGCTGCGGTTCGCCAGCGACGAGGCCTATCAGCGCCATCTCACGCAGTCCTCCGTGAAACTAGAAGGTCCGTACTGCGAGGAGTGCAAGCTGCGGTTCGCCAGCGACGAGGCCTATCAGCGCCATCTCACGCAGTCCTCCGTGAAACTAGAAGGTCCGTACTGCGAGGAGTGCAAGCTGCGGTTCGCCAGCGACGAGGCCTATCAGCGCCATCTCACGCAGTCCTCCGTACACAGCAGCGACAGTAACCCGAACCGCGTCCGCAATGAGTCACATGCTACGTATAAGGTGCAGACGCGGAACACGATAAAGCAGCGGCTTGCGGCCGGCAAACCGATACCTTGCGAGGAGTGCGGCGAGCAGCAGGCCAGCTACAGAGAGTACGCGCGACACTTCCGCGCGGCGCACCCCGGCTTCGTCCGCACCAAGATCAGAGCCAACTACATGTGCGACCAGTGCGGCAGGAGGTTTCATTGCGCGGCGGTGCTCCGGGACCACATGTCGTGCCACGAGGGCGTGAGTCGGCACCGGTGCGACGTCTGCGACAAGGCGTTCAGCAGTAAGTACCTGCTGGGGACGCACCGACTGAAGCACGGATCGAAGCCGCCGACGTACCCCTGCCCGCACTGCGAGCGCACCTATACGGCCTACTCGAACCGCGAACGTCACGTGAAGACGGTGCACGAGCGCTCGATGCGATTCGAGTGTAAGATCTGTGGCAAGGAAGTCACGTCGATGGCGAGCTTGCGCGATCACATCGACCACGTGCATCACAAGAAGCCGTGGCCCAAGCGAGTGCGCGCGCCCCGCTCGCGCTCGCGACCGTCCACCGACAGCGAGTAA
- Protein Sequence
- MVKLEGPYCEECKLRFASDEAYQRHLTQSSVKLEGPYCEECKLRFASDEAYQRHLTQSSVKLEGPYCEECKLRFASDEAYQRHLTQSSVKLEGPYCEECKLRFASDEAYQRHLTQSSVKLEGPYCEECKLRFASDEAYQRHLTQSSVHSSDSNPNRVRNESHATYKVQTRNTIKQRLAAGKPIPCEECGEQQASYREYARHFRAAHPGFVRTKIRANYMCDQCGRRFHCAAVLRDHMSCHEGVSRHRCDVCDKAFSSKYLLGTHRLKHGSKPPTYPCPHCERTYTAYSNRERHVKTVHERSMRFECKICGKEVTSMASLRDHIDHVHHKKPWPKRVRAPRSRSRPSTDSE
Similar Transcription Factors
Sequence clustering based on sequence similarity using MMseqs2
- 100% Identity
- iTF_00934231;
- 90% Identity
- -
- 80% Identity
- -