Lbel018365.1
Basic Information
- Insect
- Lysandra bellargus
- Gene Symbol
- -
- Assembly
- GCA_905333045.1
- Location
- HG995336.1:7906099-7906989[-]
Transcription Factor Domain
- TF Family
- TF_bZIP
- Domain
- bZIP domain
- PFAM
- AnimalTFDB
- TF Group
- Basic Domians group
- Description
- bZIP proteins are homo- or heterodimers that contain highly basic DNA binding regions adjacent to regions of α-helix that fold together as coiled coils
- Hmmscan Out
-
# of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc 1 5 0.97 9.4e+02 0.6 9.1 44 44 68 68 3 119 0.68 2 5 0.02 19 6.0 1.3 35 52 108 125 93 138 0.49 3 5 0.02 19 6.0 1.1 35 55 136 156 123 166 0.51 4 5 0.023 22 5.8 2.2 42 52 171 181 149 203 0.50 5 5 1.2 1.1e+03 0.3 8.4 48 48 219 219 184 295 0.70
Sequence Information
- Coding Sequence
- ATGAAATCCAAAATCCGAACTCCGAAATCCGAACTCCGAAATTCGAACTCCGAAATCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAACTCCGAAATCCGAACTCCGAACTCCGAACTCCGAAATCCGAACTCCGAACTCCGAACTCCGAAATCCGAACTCCGAAATCCGAACTCCGAAATCCGAACTCCGAAATCCGAACTCCGAAATCCGAACTCCGAAATCCGAACTCCGAAATCCGAACTCCGAAATCCGAACTGA
- Protein Sequence
- MKSKIRTPKSELRNSNSEIRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSELRTPNSEIRTPNSELRNPNSELRTPKSELRNPNSEIRTPKSELRNPNSEIRTPKSELRNPN
Similar Transcription Factors
Sequence clustering based on sequence similarity using MMseqs2
- 100% Identity
- -
- 90% Identity
- -
- 80% Identity
- -