Basic Information

Insect: Lerema accius
Gene Symbol: SCRT1
Assembly: None
Location: scaffold870:379554-390928[+]

Transcription Factor Domain

TF Family: zf-C2H2
Domain: zf-C2H2 domain
PFAM: PF00096
TF Group: Zinc-Coordinating Group
Description: The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [1].
Hmmscan Out: # of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc

1 5 6e-08 3.7e-06 27.0 1.7 1 23 231 253 231 253 0.99

2 5 0.0011 0.065 13.7 0.0 2 23 263 284 262 284 0.97

3 5 6.7e-06 0.00041 20.6 0.2 1 23 288 310 288 310 0.97

4 5 2.8e-08 1.7e-06 28.1 0.6 3 23 318 338 316 338 0.98

5 5 0.00013 0.0081 16.5 1.8 1 21 344 364 344 365 0.94

#	of	c-Evalue	i-Evalue	score	bias	hmm coord from	hmm coord to	ali coord from	ali coord to	env coord from	env coord to	acc
1	5	6e-08	3.7e-06	27.0	1.7	1	23	231	253	231	253	0.99
2	5	0.0011	0.065	13.7	0.0	2	23	263	284	262	284	0.97
3	5	6.7e-06	0.00041	20.6	0.2	1	23	288	310	288	310	0.97
4	5	2.8e-08	1.7e-06	28.1	0.6	3	23	318	338	316	338	0.98
5	5	0.00013	0.0081	16.5	1.8	1	21	344	364	344	365	0.94

Sequence Information

Coding Sequence: ATGAGTAAAAAATGTGAAAGTCGTGAAAGAGAAATTCCAGTCTACACTCTACAGGTTAGAGTGAGGCGATGCCACAGGTTGCTTCTACTTTTCTCTGCAGGATACACAGAGGAGCAGCCTTCCACGCAATTCACCGCGCAGTTGCCTAGCGAGGTGAGCCCGGCCGCCGGCACCGCCTCTCAGCCGGCACCGCAGCCTCACTCTTACGCCCTTCTGCAACTCTCCGCCTCTGATTCCACTGAACAGTCTTTCCTTCAAGTGCAGCTCCAGTCTTCGCCTGTCTCCCCCCCTCCGCCACCGGCGAGCGGCAAGTCACTCTCCATGTGCTACACCAGTACTGGCACCCTTCTATCTTTGCCACCCAAAAAGAAGGACATCTATCGCCCTTACTGCCTCGGTGACCGTGCGTACCTACAACGACCAGAAGAAGACCTCAATGCGGCCCACGCTATTCTCGACCTCAGCCAGCACGCAGTCTATCTGACCACGCCCCAGCGCGCCGAGCCCGCAGTGACCGAGCCGCCCGCCCCTCCGCCGGAGTCACCTCCGCAAGAACAACAAGCTGAAAAACCACGAGAAACCGTCGCTTACACTTACGACGCCTTCTTCGTGAGCGACGGTCGTTCCAAACGCAGAAACTACGCTAACGCCCCGGTGGAGAGTGCGCAACAACCCGAGCACAAGTCGAAATACACGTGTAGTGAATGCGGCAAGCGCTACGCCACGTCTTCCAATTTGTCACGGCACAAACAGACACACCGTAGCTTGGATTCCGTATCCGCCAAGCGCTGTGGCGAGTGTGGAAAAGCCTACGTCTCGATGCCCGCTCTCGCAATGCACGTATTGACGCATCAATTGTCACATGTTTGCGGCGTGTGTGGTAAGCTATTCTCGCGTCCGTGGCTGCTACAAGGACACCTACGCTCGCACACAGGCGAAAAACCCTACGGATGTGCACATTGTGGGAAAGCTTTCGCAGATCGGTCGAATTTGCGAGCACACATGCAGACTCACTCCTCTGATAAAAATTTCGAATGTTTGCGTTGTCACAAAACGTTCGCGCTGAAGAGCTACCTCAACAAACACCAGGAGTCGGCGTGCATTCGCGACGAAGATTCTTCGGAATCAGAGGCACCCGCCTCGGCGACCGGATAG
Protein Sequence: MSKKCESREREIPVYTLQVRVRRCHRLLLLFSAGYTEEQPSTQFTAQLPSEVSPAAGTASQPAPQPHSYALLQLSASDSTEQSFLQVQLQSSPVSPPPPPASGKSLSMCYTSTGTLLSLPPKKKDIYRPYCLGDRAYLQRPEEDLNAAHAILDLSQHAVYLTTPQRAEPAVTEPPAPPPESPPQEQQAEKPRETVAYTYDAFFVSDGRSKRRNYANAPVESAQQPEHKSKYTCSECGKRYATSSNLSRHKQTHRSLDSVSAKRCGECGKAYVSMPALAMHVLTHQLSHVCGVCGKLFSRPWLLQGHLRSHTGEKPYGCAHCGKAFADRSNLRAHMQTHSSDKNFECLRCHKTFALKSYLNKHQESACIRDEDSSESEAPASATG

Similar Transcription Factors

Sequence clustering based on sequence similarity using MMseqs2

100% Identity: iTF_01252129;
90% Identity: iTF_00795945;
80% Identity: -