Lqua032353.1
Basic Information
- Insect
- Leptura quadrifasciata
- Gene Symbol
- H15
- Assembly
- GCA_963675555.1
- Location
- OY776676.1:50460594-50461934[-]
Transcription Factor Domain
- TF Family
- T-box
- Domain
- T-box domain
- PFAM
- PF00907
- TF Group
- Unclassified Structure
- Description
- The T-box encodes a 180 amino acid domain that binds to DNA. Genes encoding T-box proteins are found in a wide range of animals, but not in other kingdoms such as plants. Family members are all thought to bind to the DNA consensus sequence TCACACCT. they are found exclusively in the nucleus, and perform DNA-binding and transcriptional activation/repression roles. They are generally required for development of the specific tissues they are expressed in, and mutations in T-box genes are implicated in human conditions such as DiGeorge syndrome and X-linked cleft palate, which feature malformations [1].
- Hmmscan Out
-
# of c-Evalue i-Evalue score bias hmm coord from hmm coord to ali coord from ali coord to env coord from env coord to acc 1 1 3.5e-10 2.9e-06 29.4 0.0 1 26 139 164 139 164 0.96
Sequence Information
- Coding Sequence
- ATGTTGCTTGGAGCAATGCCCGAAGATAGTGCCCCTGCGGGACTCCTTGTGCCCACGGCAAAGAGCCAGAGGGCTACGGACTTTTCTATTGCCGCGATTATGGCTAGAGGTGCGACACCGCCGGACGCCGACTCTATGGTAGCAACCGACGGTGGACTCTCGCGTTTGAGTTCTCCAGATATAGAGGAGCCGTTAGAGGACGATGATATCGAAGTAGATGTAGAAGAGTGTTCAGATAGCGAGTCCTCGAGGATGGCCAAACCAAAGTTAATGAGACAGAGCCCGGCTATATCAGACTGCGGCTCAGAACCGGCGGACTTAGACCGAGATTCGCCTGACATTATTTCTGAAAAATCGTCAACAACTAAAACCCAAAAAATTTTATGTAATTGTGAAGAGTTGCTGAACGTAGAATGCCACTTAGAAACCAAAGATCTATGGGACAAATTTCACGATCTTGGAACCGAAATGATCATCACTAAAACGGGGAGGTAA
- Protein Sequence
- MLLGAMPEDSAPAGLLVPTAKSQRATDFSIAAIMARGATPPDADSMVATDGGLSRLSSPDIEEPLEDDDIEVDVEECSDSESSRMAKPKLMRQSPAISDCGSEPADLDRDSPDIISEKSSTTKTQKILCNCEELLNVECHLETKDLWDKFHDLGTEMIITKTGR
Similar Transcription Factors
Sequence clustering based on sequence similarity using MMseqs2
- 100% Identity
- iTF_01310545;
- 90% Identity
- iTF_01290011;
- 80% Identity
- -